FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638038_at:

>probe:Drosophila_2:1638038_at:671:151; Interrogation_Position=1024; Antisense; ACAGGAAGTCGTACCATGTCCGGTT
>probe:Drosophila_2:1638038_at:433:61; Interrogation_Position=1039; Antisense; ATGTCCGGTTCCTATGTGCAGCGCA
>probe:Drosophila_2:1638038_at:628:353; Interrogation_Position=1056; Antisense; GCAGCGCACAGATTTTCTCAGCAAG
>probe:Drosophila_2:1638038_at:152:587; Interrogation_Position=514; Antisense; TGGACTTTTAGCGATAACCCCGATC
>probe:Drosophila_2:1638038_at:362:455; Interrogation_Position=583; Antisense; GATAATACCTATTTCTGCGATGCAG
>probe:Drosophila_2:1638038_at:273:557; Interrogation_Position=610; Antisense; GGACTACAGGCTCTACATTGCATTG
>probe:Drosophila_2:1638038_at:40:607; Interrogation_Position=669; Antisense; TGATGGTCTGCATGTGGTTCACGAA
>probe:Drosophila_2:1638038_at:13:685; Interrogation_Position=706; Antisense; TATCCCGCCGCTTATGATGTACTGT
>probe:Drosophila_2:1638038_at:578:599; Interrogation_Position=723; Antisense; TGTACTGTGCAGTGTCCAAGTTCCT
>probe:Drosophila_2:1638038_at:704:679; Interrogation_Position=847; Antisense; TATGATCGCGCCGTGTTTAATACCA
>probe:Drosophila_2:1638038_at:589:67; Interrogation_Position=886; Antisense; ATGGCCGAGTTCTATGACAGTCTTC
>probe:Drosophila_2:1638038_at:66:309; Interrogation_Position=912; Antisense; CCAGCTTTTGCTAATCGTCAGGGAT
>probe:Drosophila_2:1638038_at:189:153; Interrogation_Position=942; Antisense; ACAGCAGTGGGCTCTCAAGCTATGT
>probe:Drosophila_2:1638038_at:500:305; Interrogation_Position=968; Antisense; CCGGCAGCATTGTTCTTTTCGATAA

Paste this into a BLAST search page for me
ACAGGAAGTCGTACCATGTCCGGTTATGTCCGGTTCCTATGTGCAGCGCAGCAGCGCACAGATTTTCTCAGCAAGTGGACTTTTAGCGATAACCCCGATCGATAATACCTATTTCTGCGATGCAGGGACTACAGGCTCTACATTGCATTGTGATGGTCTGCATGTGGTTCACGAATATCCCGCCGCTTATGATGTACTGTTGTACTGTGCAGTGTCCAAGTTCCTTATGATCGCGCCGTGTTTAATACCAATGGCCGAGTTCTATGACAGTCTTCCCAGCTTTTGCTAATCGTCAGGGATACAGCAGTGGGCTCTCAAGCTATGTCCGGCAGCATTGTTCTTTTCGATAA

Full Affymetrix probeset data:

Annotations for 1638038_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720