FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638039_at:

>probe:Drosophila_2:1638039_at:169:521; Interrogation_Position=1033; Antisense; GTGGCCGGAAGTCTGACTCTTCTTC
>probe:Drosophila_2:1638039_at:487:305; Interrogation_Position=1061; Antisense; CCGGAATACTCGCTCTGAGACTAAT
>probe:Drosophila_2:1638039_at:598:423; Interrogation_Position=1077; Antisense; GAGACTAATGGCTACGCAGTTCTAA
>probe:Drosophila_2:1638039_at:427:245; Interrogation_Position=519; Antisense; AATTGCCCTCAATCGGTTTGCCATA
>probe:Drosophila_2:1638039_at:424:691; Interrogation_Position=535; Antisense; TTTGCCATACCGGAGGGCGTCGTCT
>probe:Drosophila_2:1638039_at:473:549; Interrogation_Position=585; Antisense; GGAGGATGGCTATGTCTCCGACATC
>probe:Drosophila_2:1638039_at:236:55; Interrogation_Position=613; Antisense; ATGACCGTCGATGTGCCGATGATCA
>probe:Drosophila_2:1638039_at:436:453; Interrogation_Position=633; Antisense; GATCAGCGAGGAGCATTGCATCAAT
>probe:Drosophila_2:1638039_at:191:55; Interrogation_Position=656; Antisense; ATGACAGCGACCTGGGCCACCTGAT
>probe:Drosophila_2:1638039_at:485:313; Interrogation_Position=671; Antisense; GCCACCTGATTCAGCCGGGAATGAT
>probe:Drosophila_2:1638039_at:222:631; Interrogation_Position=745; Antisense; TCCGGCGGACCATTGGTGTGCCAAA
>probe:Drosophila_2:1638039_at:341:13; Interrogation_Position=799; Antisense; ATTCAATGTGCCCTGCCCAGATTAC
>probe:Drosophila_2:1638039_at:233:309; Interrogation_Position=815; Antisense; CCAGATTACCGGGTGTGTACACAGA
>probe:Drosophila_2:1638039_at:55:101; Interrogation_Position=837; Antisense; AGAGGTGTCCTACTACTACGACTGG

Paste this into a BLAST search page for me
GTGGCCGGAAGTCTGACTCTTCTTCCCGGAATACTCGCTCTGAGACTAATGAGACTAATGGCTACGCAGTTCTAAAATTGCCCTCAATCGGTTTGCCATATTTGCCATACCGGAGGGCGTCGTCTGGAGGATGGCTATGTCTCCGACATCATGACCGTCGATGTGCCGATGATCAGATCAGCGAGGAGCATTGCATCAATATGACAGCGACCTGGGCCACCTGATGCCACCTGATTCAGCCGGGAATGATTCCGGCGGACCATTGGTGTGCCAAAATTCAATGTGCCCTGCCCAGATTACCCAGATTACCGGGTGTGTACACAGAAGAGGTGTCCTACTACTACGACTGG

Full Affymetrix probeset data:

Annotations for 1638039_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720