Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638040_at:

>probe:Drosophila_2:1638040_at:288:673; Interrogation_Position=1082; Antisense; TAGCCTGCCACAAGGATAGCAACTT
>probe:Drosophila_2:1638040_at:74:99; Interrogation_Position=1118; Antisense; AGCAGTTTACCCCAGAGCGTTGGAT
>probe:Drosophila_2:1638040_at:445:467; Interrogation_Position=1136; Antisense; GTTGGATTGATCCTGCCACGGAGAA
>probe:Drosophila_2:1638040_at:138:657; Interrogation_Position=1179; Antisense; TAATGCCAGTATTGTGGTGCCCTTC
>probe:Drosophila_2:1638040_at:146:535; Interrogation_Position=1210; Antisense; GGTCGAAGATCGTGTCCAGGAAAGC
>probe:Drosophila_2:1638040_at:491:335; Interrogation_Position=1257; Antisense; GCTGCTGCTAGCTAAGATGGTCCTA
>probe:Drosophila_2:1638040_at:537:441; Interrogation_Position=1272; Antisense; GATGGTCCTAGCCTTTGATGTGAGC
>probe:Drosophila_2:1638040_at:498:175; Interrogation_Position=1313; Antisense; AAACGGAGTTCGAGTTCCTGCTGGC
>probe:Drosophila_2:1638040_at:490:181; Interrogation_Position=1342; Antisense; AAAACTCCACTCAGTCTAAGACTCA
>probe:Drosophila_2:1638040_at:191:279; Interrogation_Position=1357; Antisense; CTAAGACTCAGCGATCGGGTTTTCT
>probe:Drosophila_2:1638040_at:382:603; Interrogation_Position=1404; Antisense; TGATCCGAAAAACAGTGCCTACCCT
>probe:Drosophila_2:1638040_at:325:279; Interrogation_Position=1422; Antisense; CTACCCTCAGGCGTTTTGTATCAAA
>probe:Drosophila_2:1638040_at:432:687; Interrogation_Position=1537; Antisense; TATATCCTTTATCCCTGATGAGCCA
>probe:Drosophila_2:1638040_at:711:125; Interrogation_Position=1570; Antisense; AGCCTAGTCCTGTGAAGCAATCAAA

Paste this into a BLAST search page for me
TAGCCTGCCACAAGGATAGCAACTTAGCAGTTTACCCCAGAGCGTTGGATGTTGGATTGATCCTGCCACGGAGAATAATGCCAGTATTGTGGTGCCCTTCGGTCGAAGATCGTGTCCAGGAAAGCGCTGCTGCTAGCTAAGATGGTCCTAGATGGTCCTAGCCTTTGATGTGAGCAAACGGAGTTCGAGTTCCTGCTGGCAAAACTCCACTCAGTCTAAGACTCACTAAGACTCAGCGATCGGGTTTTCTTGATCCGAAAAACAGTGCCTACCCTCTACCCTCAGGCGTTTTGTATCAAATATATCCTTTATCCCTGATGAGCCAAGCCTAGTCCTGTGAAGCAATCAAA

Full Affymetrix probeset data:

Annotations for 1638040_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime