FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638041_at:

>probe:Drosophila_2:1638041_at:321:257; Interrogation_Position=1699; Antisense; CACAACCATTTGTAGACGTGTATAC
>probe:Drosophila_2:1638041_at:207:601; Interrogation_Position=1709; Antisense; TGTAGACGTGTATACATTGCTGTAT
>probe:Drosophila_2:1638041_at:37:409; Interrogation_Position=1713; Antisense; GACGTGTATACATTGCTGTATTACC
>probe:Drosophila_2:1638041_at:706:665; Interrogation_Position=1721; Antisense; TACATTGCTGTATTACCAATAAACT
>probe:Drosophila_2:1638041_at:565:397; Interrogation_Position=1734; Antisense; TACCAATAAACTTACAATTCTTCGT
>probe:Drosophila_2:1638041_at:201:131; Interrogation_Position=1764; Antisense; ACCTAGTTTAGTAGTTATACACAAG
>probe:Drosophila_2:1638041_at:420:665; Interrogation_Position=1781; Antisense; TACACAAGTGATAAGACACTCCCAA
>probe:Drosophila_2:1638041_at:238:509; Interrogation_Position=1788; Antisense; GTGATAAGACACTCCCAAGTTTATG
>probe:Drosophila_2:1638041_at:376:31; Interrogation_Position=1791; Antisense; ATAAGACACTCCCAAGTTTATGGTT
>probe:Drosophila_2:1638041_at:122:399; Interrogation_Position=1795; Antisense; GACACTCCCAAGTTTATGGTTATTC
>probe:Drosophila_2:1638041_at:516:65; Interrogation_Position=1810; Antisense; ATGGTTATTCTAATTATCTGCTTAA
>probe:Drosophila_2:1638041_at:286:15; Interrogation_Position=1822; Antisense; ATTATCTGCTTAATCCTTTTAGAAC
>probe:Drosophila_2:1638041_at:636:341; Interrogation_Position=1829; Antisense; GCTTAATCCTTTTAGAACTGGCTGT
>probe:Drosophila_2:1638041_at:580:655; Interrogation_Position=1832; Antisense; TAATCCTTTTAGAACTGGCTGTCTT

Paste this into a BLAST search page for me
CACAACCATTTGTAGACGTGTATACTGTAGACGTGTATACATTGCTGTATGACGTGTATACATTGCTGTATTACCTACATTGCTGTATTACCAATAAACTTACCAATAAACTTACAATTCTTCGTACCTAGTTTAGTAGTTATACACAAGTACACAAGTGATAAGACACTCCCAAGTGATAAGACACTCCCAAGTTTATGATAAGACACTCCCAAGTTTATGGTTGACACTCCCAAGTTTATGGTTATTCATGGTTATTCTAATTATCTGCTTAAATTATCTGCTTAATCCTTTTAGAACGCTTAATCCTTTTAGAACTGGCTGTTAATCCTTTTAGAACTGGCTGTCTT

Full Affymetrix probeset data:

Annotations for 1638041_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720