FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638045_at:

>probe:Drosophila_2:1638045_at:671:383; Interrogation_Position=107; Antisense; GAACTGGAGCTCAGCCTACTGGTGG
>probe:Drosophila_2:1638045_at:249:113; Interrogation_Position=114; Antisense; AGCTCAGCCTACTGGTGGGCAAGTA
>probe:Drosophila_2:1638045_at:410:517; Interrogation_Position=128; Antisense; GTGGGCAAGTAGACAATCGTATCCT
>probe:Drosophila_2:1638045_at:359:43; Interrogation_Position=143; Antisense; ATCGTATCCTTGGAAATCTCCTCGG
>probe:Drosophila_2:1638045_at:729:215; Interrogation_Position=19; Antisense; AAGATTAGCTGTTCGCTGCTGGTGC
>probe:Drosophila_2:1638045_at:9:277; Interrogation_Position=235; Antisense; CTTTTGGGTGGCAATCGTCCGCAAC
>probe:Drosophila_2:1638045_at:254:1; Interrogation_Position=300; Antisense; ATTCGGCGGTGGATACCCAATCGGA
>probe:Drosophila_2:1638045_at:554:27; Interrogation_Position=312; Antisense; ATACCCAATCGGAGGAGGCGGATAT
>probe:Drosophila_2:1638045_at:501:71; Interrogation_Position=327; Antisense; AGGCGGATATGCTGGCGGTCTTCCT
>probe:Drosophila_2:1638045_at:461:711; Interrogation_Position=347; Antisense; TTCCTGGTGGTTATCCAGGTGGCTT
>probe:Drosophila_2:1638045_at:345:591; Interrogation_Position=38; Antisense; TGGTGCTCCTTTCGCTTTGCGCTTG
>probe:Drosophila_2:1638045_at:341:717; Interrogation_Position=382; Antisense; TTCGGTGGCGGATACGGCAATCCAT
>probe:Drosophila_2:1638045_at:356:723; Interrogation_Position=54; Antisense; TTGCGCTTGTTCATACGCTCAATAT
>probe:Drosophila_2:1638045_at:625:241; Interrogation_Position=74; Antisense; AATATGAGTATCCACAGCAGCGCCC

Paste this into a BLAST search page for me
GAACTGGAGCTCAGCCTACTGGTGGAGCTCAGCCTACTGGTGGGCAAGTAGTGGGCAAGTAGACAATCGTATCCTATCGTATCCTTGGAAATCTCCTCGGAAGATTAGCTGTTCGCTGCTGGTGCCTTTTGGGTGGCAATCGTCCGCAACATTCGGCGGTGGATACCCAATCGGAATACCCAATCGGAGGAGGCGGATATAGGCGGATATGCTGGCGGTCTTCCTTTCCTGGTGGTTATCCAGGTGGCTTTGGTGCTCCTTTCGCTTTGCGCTTGTTCGGTGGCGGATACGGCAATCCATTTGCGCTTGTTCATACGCTCAATATAATATGAGTATCCACAGCAGCGCCC

Full Affymetrix probeset data:

Annotations for 1638045_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720