FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638046_at:

>probe:Drosophila_2:1638046_at:524:589; Interrogation_Position=1123; Antisense; TGGGACGACCGCTGATTGATTTTGT
>probe:Drosophila_2:1638046_at:559:5; Interrogation_Position=1137; Antisense; ATTGATTTTGTGGAGCCCCTGCTAA
>probe:Drosophila_2:1638046_at:324:383; Interrogation_Position=1205; Antisense; GAACTGGTTCGGATCTCCCATCGAT
>probe:Drosophila_2:1638046_at:420:555; Interrogation_Position=1241; Antisense; GGACGCCATCCTGTTGGGCACGAAA
>probe:Drosophila_2:1638046_at:386:355; Interrogation_Position=1258; Antisense; GCACGAAACGCATCGGCCATGGATA
>probe:Drosophila_2:1638046_at:155:457; Interrogation_Position=1279; Antisense; GATACGCCATTACCAAGCATCCTAT
>probe:Drosophila_2:1638046_at:558:605; Interrogation_Position=1303; Antisense; TGATGATGCGACTGGCCAAACTATT
>probe:Drosophila_2:1638046_at:101:27; Interrogation_Position=1332; Antisense; ATAGCCATCGAGGTGTGTCCGGTGT
>probe:Drosophila_2:1638046_at:155:505; Interrogation_Position=1348; Antisense; GTCCGGTGTCAAATCAAGTGCTGCA
>probe:Drosophila_2:1638046_at:100:287; Interrogation_Position=1374; Antisense; CTGGGCGTGGACTATCGGAATCATC
>probe:Drosophila_2:1638046_at:561:229; Interrogation_Position=1422; Antisense; AATGTCCCCATTGTTATCTCCTCAG
>probe:Drosophila_2:1638046_at:13:719; Interrogation_Position=1500; Antisense; TTCCTGGGCATTGCACCGATGAAGG
>probe:Drosophila_2:1638046_at:130:371; Interrogation_Position=1520; Antisense; GAAGGCGGACCTGAGGTTCCTCAAA
>probe:Drosophila_2:1638046_at:354:667; Interrogation_Position=1569; Antisense; TACAGTGCCCTGGTTGGCGAGGAAA

Paste this into a BLAST search page for me
TGGGACGACCGCTGATTGATTTTGTATTGATTTTGTGGAGCCCCTGCTAAGAACTGGTTCGGATCTCCCATCGATGGACGCCATCCTGTTGGGCACGAAAGCACGAAACGCATCGGCCATGGATAGATACGCCATTACCAAGCATCCTATTGATGATGCGACTGGCCAAACTATTATAGCCATCGAGGTGTGTCCGGTGTGTCCGGTGTCAAATCAAGTGCTGCACTGGGCGTGGACTATCGGAATCATCAATGTCCCCATTGTTATCTCCTCAGTTCCTGGGCATTGCACCGATGAAGGGAAGGCGGACCTGAGGTTCCTCAAATACAGTGCCCTGGTTGGCGAGGAAA

Full Affymetrix probeset data:

Annotations for 1638046_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720