FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638047_at:

>probe:Drosophila_2:1638047_at:615:507; Interrogation_Position=114; Antisense; GTGCGACTATCTTAATGCCCAGGAG
>probe:Drosophila_2:1638047_at:428:491; Interrogation_Position=163; Antisense; GTAATACCCAAGTTCGGATCCCACG
>probe:Drosophila_2:1638047_at:111:327; Interrogation_Position=197; Antisense; GCGTGCTTCTGTTACTCGGAGGCCA
>probe:Drosophila_2:1638047_at:363:313; Interrogation_Position=218; Antisense; GCCACTGGGTGATGTTTCTCCTTAA
>probe:Drosophila_2:1638047_at:641:711; Interrogation_Position=233; Antisense; TTCTCCTTAACCTGCCTATGGTGAT
>probe:Drosophila_2:1638047_at:607:277; Interrogation_Position=248; Antisense; CTATGGTGATTTGGCTTTTCTACGA
>probe:Drosophila_2:1638047_at:194:323; Interrogation_Position=288; Antisense; GCGCGATAGTCTGGGTGTCTACGAT
>probe:Drosophila_2:1638047_at:152:525; Interrogation_Position=375; Antisense; GGGCTACTACTTCGTTATGTTCTTC
>probe:Drosophila_2:1638047_at:262:601; Interrogation_Position=407; Antisense; TGTACTGCCTTATTTCGTCACTAAT
>probe:Drosophila_2:1638047_at:572:33; Interrogation_Position=43; Antisense; ATCACCCTGTTGGTCTATGGAGCAA
>probe:Drosophila_2:1638047_at:678:221; Interrogation_Position=433; Antisense; AAGGGAGATCCCATCAAGCGGTATG
>probe:Drosophila_2:1638047_at:597:245; Interrogation_Position=66; Antisense; AATTCTCCTACTCCTTATTTACTAT
>probe:Drosophila_2:1638047_at:431:701; Interrogation_Position=80; Antisense; TTATTTACTATGTCCTCACACTGGC
>probe:Drosophila_2:1638047_at:131:143; Interrogation_Position=99; Antisense; ACTGGCGGATCTGGAGTGCGACTAT

Paste this into a BLAST search page for me
GTGCGACTATCTTAATGCCCAGGAGGTAATACCCAAGTTCGGATCCCACGGCGTGCTTCTGTTACTCGGAGGCCAGCCACTGGGTGATGTTTCTCCTTAATTCTCCTTAACCTGCCTATGGTGATCTATGGTGATTTGGCTTTTCTACGAGCGCGATAGTCTGGGTGTCTACGATGGGCTACTACTTCGTTATGTTCTTCTGTACTGCCTTATTTCGTCACTAATATCACCCTGTTGGTCTATGGAGCAAAAGGGAGATCCCATCAAGCGGTATGAATTCTCCTACTCCTTATTTACTATTTATTTACTATGTCCTCACACTGGCACTGGCGGATCTGGAGTGCGACTAT

Full Affymetrix probeset data:

Annotations for 1638047_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720