FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638048_at:

>probe:Drosophila_2:1638048_at:514:459; Interrogation_Position=1010; Antisense; GATTGTTAATCTTCGGCTTCAAGGA
>probe:Drosophila_2:1638048_at:697:469; Interrogation_Position=482; Antisense; GTTCCATCACTGTTGCTCGTACAGA
>probe:Drosophila_2:1638048_at:616:439; Interrogation_Position=505; Antisense; GAGGCGGTGGTTTCTGTCCATATGC
>probe:Drosophila_2:1638048_at:479:647; Interrogation_Position=544; Antisense; TCATCGTCAGGCTGTTCGAGCAGGA
>probe:Drosophila_2:1638048_at:642:57; Interrogation_Position=591; Antisense; ATGATTGTGGACCTGGATGCCCATC
>probe:Drosophila_2:1638048_at:483:359; Interrogation_Position=619; Antisense; GCAATGGGCACGAGCGGGACTTCAA
>probe:Drosophila_2:1638048_at:237:353; Interrogation_Position=651; Antisense; GCAGCCGTCTACATTTTCGACATGT
>probe:Drosophila_2:1638048_at:391:161; Interrogation_Position=676; Antisense; ACAATGCCTTTGTCTATCCGCGGGA
>probe:Drosophila_2:1638048_at:294:587; Interrogation_Position=733; Antisense; TGGAGCTGCGCAACTACACGGAGGA
>probe:Drosophila_2:1638048_at:238:441; Interrogation_Position=756; Antisense; GATGGATTCTACCTGCGGCAACTAA
>probe:Drosophila_2:1638048_at:625:91; Interrogation_Position=808; Antisense; AGTTCCGTCCAGATATGGTCGTCTA
>probe:Drosophila_2:1638048_at:490:617; Interrogation_Position=850; Antisense; TGCTCGAGGGCGATCCATTGGGCAA
>probe:Drosophila_2:1638048_at:542:593; Interrogation_Position=868; Antisense; TGGGCAACCTGGCTATTTCCGCGGA
>probe:Drosophila_2:1638048_at:707:531; Interrogation_Position=969; Antisense; GGTGGCTACTTGAAGGCATCCGCAG

Paste this into a BLAST search page for me
GATTGTTAATCTTCGGCTTCAAGGAGTTCCATCACTGTTGCTCGTACAGAGAGGCGGTGGTTTCTGTCCATATGCTCATCGTCAGGCTGTTCGAGCAGGAATGATTGTGGACCTGGATGCCCATCGCAATGGGCACGAGCGGGACTTCAAGCAGCCGTCTACATTTTCGACATGTACAATGCCTTTGTCTATCCGCGGGATGGAGCTGCGCAACTACACGGAGGAGATGGATTCTACCTGCGGCAACTAAAGTTCCGTCCAGATATGGTCGTCTATGCTCGAGGGCGATCCATTGGGCAATGGGCAACCTGGCTATTTCCGCGGAGGTGGCTACTTGAAGGCATCCGCAG

Full Affymetrix probeset data:

Annotations for 1638048_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720