FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638051_at:

>probe:Drosophila_2:1638051_at:679:69; Interrogation_Position=1382; Antisense; AGGCCCTGCATACAGCCATTTGGTG
>probe:Drosophila_2:1638051_at:222:157; Interrogation_Position=1424; Antisense; ACACTGGCGGAGCTCCTCTGTTGAA
>probe:Drosophila_2:1638051_at:565:603; Interrogation_Position=1442; Antisense; TGTTGAAGCCCAGTGCCGTCGAGAT
>probe:Drosophila_2:1638051_at:492:625; Interrogation_Position=1455; Antisense; TGCCGTCGAGATGTCACGATTCGTT
>probe:Drosophila_2:1638051_at:204:139; Interrogation_Position=1470; Antisense; ACGATTCGTTTACTACTCCCTGGAT
>probe:Drosophila_2:1638051_at:622:145; Interrogation_Position=1484; Antisense; ACTCCCTGGATGTCTATGCCGTGTT
>probe:Drosophila_2:1638051_at:526:631; Interrogation_Position=1517; Antisense; TCCTGGGCAGCATCATTGCCAGTTG
>probe:Drosophila_2:1638051_at:318:93; Interrogation_Position=1537; Antisense; AGTTGGGTGTGGCTCCTTCGACTCT
>probe:Drosophila_2:1638051_at:458:717; Interrogation_Position=1553; Antisense; TTCGACTCTGTTGCGGATCCAGTGC
>probe:Drosophila_2:1638051_at:59:321; Interrogation_Position=1576; Antisense; GCCGCCCAGAAGACTAAGAAGGATT
>probe:Drosophila_2:1638051_at:606:371; Interrogation_Position=1593; Antisense; GAAGGATTAGCTCGACTCATCCCTG
>probe:Drosophila_2:1638051_at:545:263; Interrogation_Position=1620; Antisense; CAGCTTCGTTTGTGGTCTATGTGAT
>probe:Drosophila_2:1638051_at:127:303; Interrogation_Position=1691; Antisense; CCCCACGGACTGTATCTAGATGTAA
>probe:Drosophila_2:1638051_at:213:99; Interrogation_Position=1708; Antisense; AGATGTAATCCTAGCGACGCCAAAT

Paste this into a BLAST search page for me
AGGCCCTGCATACAGCCATTTGGTGACACTGGCGGAGCTCCTCTGTTGAATGTTGAAGCCCAGTGCCGTCGAGATTGCCGTCGAGATGTCACGATTCGTTACGATTCGTTTACTACTCCCTGGATACTCCCTGGATGTCTATGCCGTGTTTCCTGGGCAGCATCATTGCCAGTTGAGTTGGGTGTGGCTCCTTCGACTCTTTCGACTCTGTTGCGGATCCAGTGCGCCGCCCAGAAGACTAAGAAGGATTGAAGGATTAGCTCGACTCATCCCTGCAGCTTCGTTTGTGGTCTATGTGATCCCCACGGACTGTATCTAGATGTAAAGATGTAATCCTAGCGACGCCAAAT

Full Affymetrix probeset data:

Annotations for 1638051_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720