FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638052_at:

>probe:Drosophila_2:1638052_at:401:273; Interrogation_Position=104; Antisense; CATTGCGTTTCTGATGTATTAATTA
>probe:Drosophila_2:1638052_at:19:13; Interrogation_Position=121; Antisense; ATTAATTAAAGGATGTGGAGGCGTA
>probe:Drosophila_2:1638052_at:417:575; Interrogation_Position=140; Antisense; GGCGTAATTATTGGATCTGCTGTAT
>probe:Drosophila_2:1638052_at:215:3; Interrogation_Position=149; Antisense; ATTGGATCTGCTGTATCTTTCTTAA
>probe:Drosophila_2:1638052_at:106:643; Interrogation_Position=155; Antisense; TCTGCTGTATCTTTCTTAATTTTAA
>probe:Drosophila_2:1638052_at:349:701; Interrogation_Position=174; Antisense; TTTTAAAGAGACGAGCATGGCCTGT
>probe:Drosophila_2:1638052_at:450:99; Interrogation_Position=180; Antisense; AGAGACGAGCATGGCCTGTATGGCT
>probe:Drosophila_2:1638052_at:350:115; Interrogation_Position=187; Antisense; AGCATGGCCTGTATGGCTCGGCGCT
>probe:Drosophila_2:1638052_at:643:331; Interrogation_Position=209; Antisense; GCTGGATTTGGAATGGGCATCGCTT
>probe:Drosophila_2:1638052_at:654:229; Interrogation_Position=220; Antisense; AATGGGCATCGCTTATAGGACGTGT
>probe:Drosophila_2:1638052_at:214:347; Interrogation_Position=225; Antisense; GCATCGCTTATAGGACGTGTGAAAA
>probe:Drosophila_2:1638052_at:588:725; Interrogation_Position=41; Antisense; TTGGCAATAAAAATGACTTCTCGCG
>probe:Drosophila_2:1638052_at:445:611; Interrogation_Position=54; Antisense; TGACTTCTCGCGATAATATTTTCGA
>probe:Drosophila_2:1638052_at:340:25; Interrogation_Position=93; Antisense; ATAGATTAGATCATTGCGTTTCTGA

Paste this into a BLAST search page for me
CATTGCGTTTCTGATGTATTAATTAATTAATTAAAGGATGTGGAGGCGTAGGCGTAATTATTGGATCTGCTGTATATTGGATCTGCTGTATCTTTCTTAATCTGCTGTATCTTTCTTAATTTTAATTTTAAAGAGACGAGCATGGCCTGTAGAGACGAGCATGGCCTGTATGGCTAGCATGGCCTGTATGGCTCGGCGCTGCTGGATTTGGAATGGGCATCGCTTAATGGGCATCGCTTATAGGACGTGTGCATCGCTTATAGGACGTGTGAAAATTGGCAATAAAAATGACTTCTCGCGTGACTTCTCGCGATAATATTTTCGAATAGATTAGATCATTGCGTTTCTGA

Full Affymetrix probeset data:

Annotations for 1638052_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720