Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638053_at:

>probe:Drosophila_2:1638053_at:706:269; Interrogation_Position=1176; Antisense; CATGAAGGAAACTACGCGCCTGTTT
>probe:Drosophila_2:1638053_at:514:691; Interrogation_Position=1214; Antisense; TTATGGGTCGTGAAGCCGTCCAGGA
>probe:Drosophila_2:1638053_at:159:75; Interrogation_Position=1235; Antisense; AGGAGACTGAACTGGCCAATGGACT
>probe:Drosophila_2:1638053_at:562:579; Interrogation_Position=1248; Antisense; GGCCAATGGACTGATCCTGCCAAAG
>probe:Drosophila_2:1638053_at:407:323; Interrogation_Position=1274; Antisense; GCGCCCAGATAACCATTCATGTCTT
>probe:Drosophila_2:1638053_at:107:311; Interrogation_Position=1315; Antisense; GCCAAGTACTGGGATTCGCCTGAAG
>probe:Drosophila_2:1638053_at:50:215; Interrogation_Position=1337; Antisense; AAGAGTTCCGTCCTGAGAGATTCCT
>probe:Drosophila_2:1638053_at:113:425; Interrogation_Position=1351; Antisense; GAGAGATTCCTACCCGAAAATGTGC
>probe:Drosophila_2:1638053_at:359:507; Interrogation_Position=1372; Antisense; GTGCAGGATCGTCATACGTACGCTT
>probe:Drosophila_2:1638053_at:255:671; Interrogation_Position=1386; Antisense; TACGTACGCTTATGTTCCCTTCAGT
>probe:Drosophila_2:1638053_at:223:177; Interrogation_Position=1460; Antisense; AAACGCTGATGGTGGTCCTTCTGAA
>probe:Drosophila_2:1638053_at:217:477; Interrogation_Position=1495; Antisense; GTTTTGAAGGCTATCGATCCGCAGA
>probe:Drosophila_2:1638053_at:546:373; Interrogation_Position=1518; Antisense; GAAGATTGTCTTCCATACGGGTATA
>probe:Drosophila_2:1638053_at:18:661; Interrogation_Position=1541; Antisense; TAACTCTGCGCACCCAAGACAAGAT

Paste this into a BLAST search page for me
CATGAAGGAAACTACGCGCCTGTTTTTATGGGTCGTGAAGCCGTCCAGGAAGGAGACTGAACTGGCCAATGGACTGGCCAATGGACTGATCCTGCCAAAGGCGCCCAGATAACCATTCATGTCTTGCCAAGTACTGGGATTCGCCTGAAGAAGAGTTCCGTCCTGAGAGATTCCTGAGAGATTCCTACCCGAAAATGTGCGTGCAGGATCGTCATACGTACGCTTTACGTACGCTTATGTTCCCTTCAGTAAACGCTGATGGTGGTCCTTCTGAAGTTTTGAAGGCTATCGATCCGCAGAGAAGATTGTCTTCCATACGGGTATATAACTCTGCGCACCCAAGACAAGAT

Full Affymetrix probeset data:

Annotations for 1638053_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime