Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638054_at:

>probe:Drosophila_2:1638054_at:91:43; Interrogation_Position=100; Antisense; ATCGTTCATCGCAGTGTTCCGAGGA
>probe:Drosophila_2:1638054_at:299:647; Interrogation_Position=105; Antisense; TCATCGCAGTGTTCCGAGGACTACA
>probe:Drosophila_2:1638054_at:536:603; Interrogation_Position=114; Antisense; TGTTCCGAGGACTACATCACTGTTG
>probe:Drosophila_2:1638054_at:379:437; Interrogation_Position=120; Antisense; GAGGACTACATCACTGTTGACACCC
>probe:Drosophila_2:1638054_at:182:667; Interrogation_Position=126; Antisense; TACATCACTGTTGACACCCGCTTTG
>probe:Drosophila_2:1638054_at:439:725; Interrogation_Position=148; Antisense; TTGAGGTCCACCTATCTGAACTATC
>probe:Drosophila_2:1638054_at:183:131; Interrogation_Position=157; Antisense; ACCTATCTGAACTATCCCACCTGGG
>probe:Drosophila_2:1638054_at:348:529; Interrogation_Position=180; Antisense; GGGTTATCCACTTTTCGATGGCACC
>probe:Drosophila_2:1638054_at:503:703; Interrogation_Position=183; Antisense; TTATCCACTTTTCGATGGCACCAAC
>probe:Drosophila_2:1638054_at:150:127; Interrogation_Position=30; Antisense; ACCAACTTTTGCCAAGGTGGGCCAT
>probe:Drosophila_2:1638054_at:546:579; Interrogation_Position=49; Antisense; GGCCATCTGGTGGAGCATGTGCCCA
>probe:Drosophila_2:1638054_at:34:533; Interrogation_Position=57; Antisense; GGTGGAGCATGTGCCCACCGCAGTT
>probe:Drosophila_2:1638054_at:260:127; Interrogation_Position=73; Antisense; ACCGCAGTTTCGCACCAGAGTTCCA
>probe:Drosophila_2:1638054_at:529:101; Interrogation_Position=89; Antisense; AGAGTTCCACCATCGTTCATCGCAG

Paste this into a BLAST search page for me
ATCGTTCATCGCAGTGTTCCGAGGATCATCGCAGTGTTCCGAGGACTACATGTTCCGAGGACTACATCACTGTTGGAGGACTACATCACTGTTGACACCCTACATCACTGTTGACACCCGCTTTGTTGAGGTCCACCTATCTGAACTATCACCTATCTGAACTATCCCACCTGGGGGGTTATCCACTTTTCGATGGCACCTTATCCACTTTTCGATGGCACCAACACCAACTTTTGCCAAGGTGGGCCATGGCCATCTGGTGGAGCATGTGCCCAGGTGGAGCATGTGCCCACCGCAGTTACCGCAGTTTCGCACCAGAGTTCCAAGAGTTCCACCATCGTTCATCGCAG

Full Affymetrix probeset data:

Annotations for 1638054_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime