Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638055_at:

>probe:Drosophila_2:1638055_at:167:615; Interrogation_Position=500; Antisense; TGAAGTTCCACATCATCACACTGTT
>probe:Drosophila_2:1638055_at:564:555; Interrogation_Position=534; Antisense; GGACGAAGTGCTCATCCAGATGGAC
>probe:Drosophila_2:1638055_at:544:603; Interrogation_Position=608; Antisense; TGTTGGCCATCATCCCGTGGAAGTT
>probe:Drosophila_2:1638055_at:488:563; Interrogation_Position=626; Antisense; GGAAGTTCCACATCATCACACTGTT
>probe:Drosophila_2:1638055_at:191:157; Interrogation_Position=643; Antisense; ACACTGTTGTCGAAACCGGCCGAAG
>probe:Drosophila_2:1638055_at:106:579; Interrogation_Position=660; Antisense; GGCCGAAGTGCTCATCCAGATGGAC
>probe:Drosophila_2:1638055_at:651:603; Interrogation_Position=734; Antisense; TGTTGGCAACCATCCCGTTGAGGTT
>probe:Drosophila_2:1638055_at:234:467; Interrogation_Position=750; Antisense; GTTGAGGTTCCTCATCATCACACTG
>probe:Drosophila_2:1638055_at:658:269; Interrogation_Position=765; Antisense; CATCACACTGTCGTTGAGAGCGGTC
>probe:Drosophila_2:1638055_at:202:499; Interrogation_Position=787; Antisense; GTCGAAGTGCTCATCCAGAGGTGCC
>probe:Drosophila_2:1638055_at:186:101; Interrogation_Position=803; Antisense; AGAGGTGCCCCATTCTATCGAACAC
>probe:Drosophila_2:1638055_at:710:645; Interrogation_Position=890; Antisense; TCATCCCGTTTCTGATACCGCAGAA
>probe:Drosophila_2:1638055_at:593:709; Interrogation_Position=940; Antisense; TTCAACGCGTCCACGATGAAGGCGT
>probe:Drosophila_2:1638055_at:730:215; Interrogation_Position=984; Antisense; AAGATTCCAGTTGCTGTGGCTCGCA

Paste this into a BLAST search page for me
TGAAGTTCCACATCATCACACTGTTGGACGAAGTGCTCATCCAGATGGACTGTTGGCCATCATCCCGTGGAAGTTGGAAGTTCCACATCATCACACTGTTACACTGTTGTCGAAACCGGCCGAAGGGCCGAAGTGCTCATCCAGATGGACTGTTGGCAACCATCCCGTTGAGGTTGTTGAGGTTCCTCATCATCACACTGCATCACACTGTCGTTGAGAGCGGTCGTCGAAGTGCTCATCCAGAGGTGCCAGAGGTGCCCCATTCTATCGAACACTCATCCCGTTTCTGATACCGCAGAATTCAACGCGTCCACGATGAAGGCGTAAGATTCCAGTTGCTGTGGCTCGCA

Full Affymetrix probeset data:

Annotations for 1638055_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime