FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638057_at:

>probe:Drosophila_2:1638057_at:312:165; Interrogation_Position=1031; Antisense; AAATCAGAGAGCTGCTGCCATGGAT
>probe:Drosophila_2:1638057_at:643:289; Interrogation_Position=489; Antisense; CGTACTTTCGAAACTGGCTGCTTAT
>probe:Drosophila_2:1638057_at:145:281; Interrogation_Position=527; Antisense; CTGCCTATATAGCTAAGACTCCCGG
>probe:Drosophila_2:1638057_at:19:407; Interrogation_Position=603; Antisense; GACTGCCGAACTGAAGAGCTTGTAT
>probe:Drosophila_2:1638057_at:269:461; Interrogation_Position=635; Antisense; GATTTCACGAAAGTCTCCGATCCAA
>probe:Drosophila_2:1638057_at:373:457; Interrogation_Position=712; Antisense; GATACGCTCTTCAGTGGTTTTCACA
>probe:Drosophila_2:1638057_at:240:541; Interrogation_Position=727; Antisense; GGTTTTCACACTGCCCAATATGGTC
>probe:Drosophila_2:1638057_at:672:681; Interrogation_Position=745; Antisense; TATGGTCCAGCTGTATACGATCTAT
>probe:Drosophila_2:1638057_at:723:451; Interrogation_Position=763; Antisense; GATCTATTCAGTTCACTTCTCACGG
>probe:Drosophila_2:1638057_at:241:643; Interrogation_Position=782; Antisense; TCACGGCCCCAGCTGAAAAATCTAG
>probe:Drosophila_2:1638057_at:326:301; Interrogation_Position=886; Antisense; CCCAGCCTCACGGATTTACAATTAG
>probe:Drosophila_2:1638057_at:442:395; Interrogation_Position=918; Antisense; GAAATACGGCCATTGGGCATTTGAA
>probe:Drosophila_2:1638057_at:369:391; Interrogation_Position=940; Antisense; GAAACTGCCACGGAAATACTGCCTA
>probe:Drosophila_2:1638057_at:540:277; Interrogation_Position=962; Antisense; CTATCGTTCTCTCGGACTTTGGAAA

Paste this into a BLAST search page for me
AAATCAGAGAGCTGCTGCCATGGATCGTACTTTCGAAACTGGCTGCTTATCTGCCTATATAGCTAAGACTCCCGGGACTGCCGAACTGAAGAGCTTGTATGATTTCACGAAAGTCTCCGATCCAAGATACGCTCTTCAGTGGTTTTCACAGGTTTTCACACTGCCCAATATGGTCTATGGTCCAGCTGTATACGATCTATGATCTATTCAGTTCACTTCTCACGGTCACGGCCCCAGCTGAAAAATCTAGCCCAGCCTCACGGATTTACAATTAGGAAATACGGCCATTGGGCATTTGAAGAAACTGCCACGGAAATACTGCCTACTATCGTTCTCTCGGACTTTGGAAA

Full Affymetrix probeset data:

Annotations for 1638057_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720