FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638059_at:

>probe:Drosophila_2:1638059_at:593:591; Interrogation_Position=1022; Antisense; TGGTGGAAATACTGCCGCACGTCAT
>probe:Drosophila_2:1638059_at:703:281; Interrogation_Position=1063; Antisense; CTCGAGGCCCTCCATAAATATGCAA
>probe:Drosophila_2:1638059_at:199:245; Interrogation_Position=1090; Antisense; AATTTCGCCAAGATCATCGCAGAGA
>probe:Drosophila_2:1638059_at:345:109; Interrogation_Position=1121; Antisense; AGAAGCAGGGAACCATCACCACTAG
>probe:Drosophila_2:1638059_at:386:619; Interrogation_Position=1166; Antisense; TGCTGCATTCCGTACAGGAGACTTT
>probe:Drosophila_2:1638059_at:553:153; Interrogation_Position=1179; Antisense; ACAGGAGACTTTCGCCCAGAATCTG
>probe:Drosophila_2:1638059_at:43:333; Interrogation_Position=1246; Antisense; GCGGCCATATCGTCTGCCAAATGAG
>probe:Drosophila_2:1638059_at:71:427; Interrogation_Position=1334; Antisense; GAGATCTACATTCGAGTCCAGTTCC
>probe:Drosophila_2:1638059_at:56:125; Interrogation_Position=776; Antisense; AGCCGGACAAGTTGAGCCGCCTTAC
>probe:Drosophila_2:1638059_at:615:71; Interrogation_Position=830; Antisense; AGGCAGTGCGTCATCTAAGCACCAA
>probe:Drosophila_2:1638059_at:674:573; Interrogation_Position=855; Antisense; GGCGGCCCTGATACAGCCTGATAAA
>probe:Drosophila_2:1638059_at:267:361; Interrogation_Position=917; Antisense; GCAAGATGGATGCTATCGCCGAAAA
>probe:Drosophila_2:1638059_at:532:625; Interrogation_Position=954; Antisense; TGCCCAGGACGCCAAACGAGATCAG
>probe:Drosophila_2:1638059_at:338:1; Interrogation_Position=982; Antisense; ATTACGGAACTATACGACATCGCGA

Paste this into a BLAST search page for me
TGGTGGAAATACTGCCGCACGTCATCTCGAGGCCCTCCATAAATATGCAAAATTTCGCCAAGATCATCGCAGAGAAGAAGCAGGGAACCATCACCACTAGTGCTGCATTCCGTACAGGAGACTTTACAGGAGACTTTCGCCCAGAATCTGGCGGCCATATCGTCTGCCAAATGAGGAGATCTACATTCGAGTCCAGTTCCAGCCGGACAAGTTGAGCCGCCTTACAGGCAGTGCGTCATCTAAGCACCAAGGCGGCCCTGATACAGCCTGATAAAGCAAGATGGATGCTATCGCCGAAAATGCCCAGGACGCCAAACGAGATCAGATTACGGAACTATACGACATCGCGA

Full Affymetrix probeset data:

Annotations for 1638059_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720