FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638060_at:

>probe:Drosophila_2:1638060_at:681:477; Interrogation_Position=1941; Antisense; GTTTCTAGCATTGCGGAGATCCGTG
>probe:Drosophila_2:1638060_at:538:97; Interrogation_Position=1957; Antisense; AGATCCGTGGGATCTCCATCATCAC
>probe:Drosophila_2:1638060_at:432:37; Interrogation_Position=1974; Antisense; ATCATCACGGCCCAGTTGCGAGGAC
>probe:Drosophila_2:1638060_at:329:469; Interrogation_Position=1988; Antisense; GTTGCGAGGACACCATCTCCAGGGA
>probe:Drosophila_2:1638060_at:220:35; Interrogation_Position=2002; Antisense; ATCTCCAGGGACTCTTATTCGTAAG
>probe:Drosophila_2:1638060_at:370:11; Interrogation_Position=2031; Antisense; ATTCTAATCCCATATTCTAACCCTA
>probe:Drosophila_2:1638060_at:309:571; Interrogation_Position=2076; Antisense; GGCTAATTTATTTCTTCCTAATCAT
>probe:Drosophila_2:1638060_at:114:239; Interrogation_Position=2095; Antisense; AATCATAGCAATATGCCCGCATCCT
>probe:Drosophila_2:1638060_at:518:717; Interrogation_Position=2129; Antisense; TTCCCTTCCATCGAAGTATGTTCCT
>probe:Drosophila_2:1638060_at:535:699; Interrogation_Position=2156; Antisense; TTTTAAACCAAATCAGCACCCTTCT
>probe:Drosophila_2:1638060_at:318:111; Interrogation_Position=2170; Antisense; AGCACCCTTCTATCATAAGCTTTGA
>probe:Drosophila_2:1638060_at:701:473; Interrogation_Position=2233; Antisense; GTTAATTTTAATCAAGCCGTCTCTT
>probe:Drosophila_2:1638060_at:58:319; Interrogation_Position=2248; Antisense; GCCGTCTCTTGTATGCATTAAGCTT
>probe:Drosophila_2:1638060_at:529:637; Interrogation_Position=2339; Antisense; TCGAGGTCCACATTTCTGCAGTATA

Paste this into a BLAST search page for me
GTTTCTAGCATTGCGGAGATCCGTGAGATCCGTGGGATCTCCATCATCACATCATCACGGCCCAGTTGCGAGGACGTTGCGAGGACACCATCTCCAGGGAATCTCCAGGGACTCTTATTCGTAAGATTCTAATCCCATATTCTAACCCTAGGCTAATTTATTTCTTCCTAATCATAATCATAGCAATATGCCCGCATCCTTTCCCTTCCATCGAAGTATGTTCCTTTTTAAACCAAATCAGCACCCTTCTAGCACCCTTCTATCATAAGCTTTGAGTTAATTTTAATCAAGCCGTCTCTTGCCGTCTCTTGTATGCATTAAGCTTTCGAGGTCCACATTTCTGCAGTATA

Full Affymetrix probeset data:

Annotations for 1638060_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720