Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638063_at:

>probe:Drosophila_2:1638063_at:124:51; Interrogation_Position=9483; Antisense; ATGCCCGCGTGGTGCGTGAGTTCAA
>probe:Drosophila_2:1638063_at:617:221; Interrogation_Position=9509; Antisense; AAGGTGGAGTCACAGCAATCGCTGC
>probe:Drosophila_2:1638063_at:728:293; Interrogation_Position=9535; Antisense; CGAGGATGCTCGTTATGTACGCCGG
>probe:Drosophila_2:1638063_at:434:93; Interrogation_Position=9585; Antisense; AGTTCATTCGCAAGGAATCCTCCTC
>probe:Drosophila_2:1638063_at:139:711; Interrogation_Position=9631; Antisense; TTCAATCGCCCAATCGCTGGTGAGG
>probe:Drosophila_2:1638063_at:162:369; Interrogation_Position=9683; Antisense; GAATCCAATGACGTTTGCAGCGTGA
>probe:Drosophila_2:1638063_at:441:451; Interrogation_Position=9706; Antisense; GATCGAGGCACCACAGATGCGTCAG
>probe:Drosophila_2:1638063_at:373:329; Interrogation_Position=9724; Antisense; GCGTCAGAATCAGAGTCACACCATG
>probe:Drosophila_2:1638063_at:239:473; Interrogation_Position=9774; Antisense; GTTCATTCCTTAACAGCAGTGCCGA
>probe:Drosophila_2:1638063_at:113:507; Interrogation_Position=9792; Antisense; GTGCCGATCAGCGACAGGTGACCAG
>probe:Drosophila_2:1638063_at:69:139; Interrogation_Position=9822; Antisense; ACGATGTCCTCGAGCGCATGCGAAA
>probe:Drosophila_2:1638063_at:415:657; Interrogation_Position=9853; Antisense; TAATGTCGAGGAGCCCGGAGATTCT
>probe:Drosophila_2:1638063_at:391:619; Interrogation_Position=9898; Antisense; TGCTCTGCTCAACAAATTCCTGGGA
>probe:Drosophila_2:1638063_at:216:299; Interrogation_Position=9967; Antisense; CGCCACGGGTCAGCGTCTAAATAGT

Paste this into a BLAST search page for me
ATGCCCGCGTGGTGCGTGAGTTCAAAAGGTGGAGTCACAGCAATCGCTGCCGAGGATGCTCGTTATGTACGCCGGAGTTCATTCGCAAGGAATCCTCCTCTTCAATCGCCCAATCGCTGGTGAGGGAATCCAATGACGTTTGCAGCGTGAGATCGAGGCACCACAGATGCGTCAGGCGTCAGAATCAGAGTCACACCATGGTTCATTCCTTAACAGCAGTGCCGAGTGCCGATCAGCGACAGGTGACCAGACGATGTCCTCGAGCGCATGCGAAATAATGTCGAGGAGCCCGGAGATTCTTGCTCTGCTCAACAAATTCCTGGGACGCCACGGGTCAGCGTCTAAATAGT

Full Affymetrix probeset data:

Annotations for 1638063_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime