FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638066_at:

>probe:Drosophila_2:1638066_at:151:317; Interrogation_Position=101; Antisense; GCCTCCGCCAGCGATTTTAAAACTG
>probe:Drosophila_2:1638066_at:268:525; Interrogation_Position=125; Antisense; GGGCAAGCACTTCCATGACATTTGT
>probe:Drosophila_2:1638066_at:551:19; Interrogation_Position=144; Antisense; ATTTGTGCTCCCAAAACTGGCGTTA
>probe:Drosophila_2:1638066_at:666:287; Interrogation_Position=160; Antisense; CTGGCGTTACTGATGAGGCCATCAA
>probe:Drosophila_2:1638066_at:162:409; Interrogation_Position=213; Antisense; GACGAGGCCCTCAAGTGCTATATGA
>probe:Drosophila_2:1638066_at:378:85; Interrogation_Position=226; Antisense; AGTGCTATATGAACTGCCTCTTCCA
>probe:Drosophila_2:1638066_at:495:259; Interrogation_Position=249; Antisense; CACGAGTTCGAGGTGGTCGACGACA
>probe:Drosophila_2:1638066_at:393:537; Interrogation_Position=29; Antisense; GGTCAAATACCCACTGATACTACTT
>probe:Drosophila_2:1638066_at:430:497; Interrogation_Position=297; Antisense; GTCTTGAACGCCATTCCGGGAGAAA
>probe:Drosophila_2:1638066_at:511:547; Interrogation_Position=341; Antisense; GGAGGCTTCCAAGGGATGCATTCAT
>probe:Drosophila_2:1638066_at:453:445; Interrogation_Position=355; Antisense; GATGCATTCATCCTGAGGGCGACAC
>probe:Drosophila_2:1638066_at:192:561; Interrogation_Position=415; Antisense; GGAAGAAGGCTGATCCTGTCCACTA
>probe:Drosophila_2:1638066_at:383:667; Interrogation_Position=46; Antisense; TACTACTTTTGATTGGCTGTGCCGC
>probe:Drosophila_2:1638066_at:375:625; Interrogation_Position=71; Antisense; TGCCCAGGAACCAAGGCGCGATGGA

Paste this into a BLAST search page for me
GCCTCCGCCAGCGATTTTAAAACTGGGGCAAGCACTTCCATGACATTTGTATTTGTGCTCCCAAAACTGGCGTTACTGGCGTTACTGATGAGGCCATCAAGACGAGGCCCTCAAGTGCTATATGAAGTGCTATATGAACTGCCTCTTCCACACGAGTTCGAGGTGGTCGACGACAGGTCAAATACCCACTGATACTACTTGTCTTGAACGCCATTCCGGGAGAAAGGAGGCTTCCAAGGGATGCATTCATGATGCATTCATCCTGAGGGCGACACGGAAGAAGGCTGATCCTGTCCACTATACTACTTTTGATTGGCTGTGCCGCTGCCCAGGAACCAAGGCGCGATGGA

Full Affymetrix probeset data:

Annotations for 1638066_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720