Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638068_a_at:

>probe:Drosophila_2:1638068_a_at:4:347; Interrogation_Position=14; Antisense; GCAAACGGTCACTCTGAATCGTTCT
>probe:Drosophila_2:1638068_a_at:514:667; Interrogation_Position=208; Antisense; TACATCGACAAGAAGTGCCCCTGGA
>probe:Drosophila_2:1638068_a_at:138:221; Interrogation_Position=220; Antisense; AAGTGCCCCTGGACCGGTGATGTGA
>probe:Drosophila_2:1638068_a_at:608:607; Interrogation_Position=242; Antisense; TGAGGATCCGTGGTCGCATTCTGAC
>probe:Drosophila_2:1638068_a_at:293:215; Interrogation_Position=286; Antisense; AAGATGCAGCGCACCATTGTCATTC
>probe:Drosophila_2:1638068_a_at:460:367; Interrogation_Position=29; Antisense; GAATCGTTCTTTCCTTTTTCATCAA
>probe:Drosophila_2:1638068_a_at:200:405; Interrogation_Position=316; Antisense; GACTACCTGCACTTTGTGCGCAAAT
>probe:Drosophila_2:1638068_a_at:729:505; Interrogation_Position=331; Antisense; GTGCGCAAATACAGCCGTTTCGAGA
>probe:Drosophila_2:1638068_a_at:465:479; Interrogation_Position=347; Antisense; GTTTCGAGAAGCGTCACCGCAACAT
>probe:Drosophila_2:1638068_a_at:523:337; Interrogation_Position=383; Antisense; GCTCCCCTGTGTTCAGAGATGTTGA
>probe:Drosophila_2:1638068_a_at:379:419; Interrogation_Position=406; Antisense; GAGCATGGCGATATTGTCACCATTG
>probe:Drosophila_2:1638068_a_at:459:127; Interrogation_Position=424; Antisense; ACCATTGGTGAGTGCCGTCCTCTGT
>probe:Drosophila_2:1638068_a_at:64:507; Interrogation_Position=457; Antisense; GTGCGCTTCAACGTCCTGAAAGTCA
>probe:Drosophila_2:1638068_a_at:289:559; Interrogation_Position=526; Antisense; GGACAACTACCATTCGGGCGATAAT

Paste this into a BLAST search page for me
GCAAACGGTCACTCTGAATCGTTCTTACATCGACAAGAAGTGCCCCTGGAAAGTGCCCCTGGACCGGTGATGTGATGAGGATCCGTGGTCGCATTCTGACAAGATGCAGCGCACCATTGTCATTCGAATCGTTCTTTCCTTTTTCATCAAGACTACCTGCACTTTGTGCGCAAATGTGCGCAAATACAGCCGTTTCGAGAGTTTCGAGAAGCGTCACCGCAACATGCTCCCCTGTGTTCAGAGATGTTGAGAGCATGGCGATATTGTCACCATTGACCATTGGTGAGTGCCGTCCTCTGTGTGCGCTTCAACGTCCTGAAAGTCAGGACAACTACCATTCGGGCGATAAT

Full Affymetrix probeset data:

Annotations for 1638068_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime