FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638070_at:

>probe:Drosophila_2:1638070_at:353:177; Interrogation_Position=111; Antisense; AAACGACCTCAGCATATGTGGCACC
>probe:Drosophila_2:1638070_at:527:615; Interrogation_Position=137; Antisense; TGCACTCGGTGGATCAGTACCTGAA
>probe:Drosophila_2:1638070_at:715:185; Interrogation_Position=15; Antisense; AACAACGCGTTCGTCGAAATTGCAA
>probe:Drosophila_2:1638070_at:74:489; Interrogation_Position=153; Antisense; GTACCTGAACATCAAGCTGACGGAT
>probe:Drosophila_2:1638070_at:109:459; Interrogation_Position=175; Antisense; GATATCAGTGTCACAGATCCGGACA
>probe:Drosophila_2:1638070_at:610:417; Interrogation_Position=216; Antisense; GAGCGTCAAGAACTGCTTCATCCGT
>probe:Drosophila_2:1638070_at:427:647; Interrogation_Position=233; Antisense; TCATCCGTGGCTCCGTGGTGCGATA
>probe:Drosophila_2:1638070_at:461:631; Interrogation_Position=244; Antisense; TCCGTGGTGCGATACGTGCAGCTGC
>probe:Drosophila_2:1638070_at:157:215; Interrogation_Position=333; Antisense; AAGATAAGAATACCACTACCAGCAG
>probe:Drosophila_2:1638070_at:501:277; Interrogation_Position=348; Antisense; CTACCAGCAGCCCAATTGGATCTAC
>probe:Drosophila_2:1638070_at:589:3; Interrogation_Position=362; Antisense; ATTGGATCTACCCATTGCTTCGTAA
>probe:Drosophila_2:1638070_at:498:305; Interrogation_Position=373; Antisense; CCATTGCTTCGTAAACTGTCCTAAA
>probe:Drosophila_2:1638070_at:691:661; Interrogation_Position=47; Antisense; TAACAATGCTCTTTTACTCCTTCTT
>probe:Drosophila_2:1638070_at:681:669; Interrogation_Position=61; Antisense; TACTCCTTCTTCAAGTCGCTGGTGG

Paste this into a BLAST search page for me
AAACGACCTCAGCATATGTGGCACCTGCACTCGGTGGATCAGTACCTGAAAACAACGCGTTCGTCGAAATTGCAAGTACCTGAACATCAAGCTGACGGATGATATCAGTGTCACAGATCCGGACAGAGCGTCAAGAACTGCTTCATCCGTTCATCCGTGGCTCCGTGGTGCGATATCCGTGGTGCGATACGTGCAGCTGCAAGATAAGAATACCACTACCAGCAGCTACCAGCAGCCCAATTGGATCTACATTGGATCTACCCATTGCTTCGTAACCATTGCTTCGTAAACTGTCCTAAATAACAATGCTCTTTTACTCCTTCTTTACTCCTTCTTCAAGTCGCTGGTGG

Full Affymetrix probeset data:

Annotations for 1638070_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720