FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638072_at:

>probe:Drosophila_2:1638072_at:613:155; Interrogation_Position=158; Antisense; ACAGCCAGGAGTTGAATAGCGTCGA
>probe:Drosophila_2:1638072_at:471:421; Interrogation_Position=184; Antisense; GAGAACGACGCCGAGGCGGATCCAT
>probe:Drosophila_2:1638072_at:279:331; Interrogation_Position=199; Antisense; GCGGATCCATCGACGTGGCGTAAGC
>probe:Drosophila_2:1638072_at:236:583; Interrogation_Position=214; Antisense; TGGCGTAAGCTCTTCGGCAGCGAAG
>probe:Drosophila_2:1638072_at:163:167; Interrogation_Position=295; Antisense; AAATCCAAGACGACCAAGCGGCCAT
>probe:Drosophila_2:1638072_at:644:47; Interrogation_Position=437; Antisense; ATCCATATCCCGGACATGGTGGACA
>probe:Drosophila_2:1638072_at:402:207; Interrogation_Position=468; Antisense; AAGCGGCGGACATGATAGCGGACAC
>probe:Drosophila_2:1638072_at:640:675; Interrogation_Position=483; Antisense; TAGCGGACACGGAGGACATCATCAC
>probe:Drosophila_2:1638072_at:404:549; Interrogation_Position=493; Antisense; GGAGGACATCATCACCACACGACTA
>probe:Drosophila_2:1638072_at:315:211; Interrogation_Position=544; Antisense; AAGAAGCCCAACCACGGACAGTATC
>probe:Drosophila_2:1638072_at:463:191; Interrogation_Position=655; Antisense; AACGATTCCGGTGAATCCAGCGAGA
>probe:Drosophila_2:1638072_at:306:403; Interrogation_Position=678; Antisense; GACTTCCGCCAAGATTTGCAAGAAG
>probe:Drosophila_2:1638072_at:499:373; Interrogation_Position=699; Antisense; GAAGTTCTTCGGTATTGGACTCATC
>probe:Drosophila_2:1638072_at:118:291; Interrogation_Position=708; Antisense; CGGTATTGGACTCATCTGCACGTAG

Paste this into a BLAST search page for me
ACAGCCAGGAGTTGAATAGCGTCGAGAGAACGACGCCGAGGCGGATCCATGCGGATCCATCGACGTGGCGTAAGCTGGCGTAAGCTCTTCGGCAGCGAAGAAATCCAAGACGACCAAGCGGCCATATCCATATCCCGGACATGGTGGACAAAGCGGCGGACATGATAGCGGACACTAGCGGACACGGAGGACATCATCACGGAGGACATCATCACCACACGACTAAAGAAGCCCAACCACGGACAGTATCAACGATTCCGGTGAATCCAGCGAGAGACTTCCGCCAAGATTTGCAAGAAGGAAGTTCTTCGGTATTGGACTCATCCGGTATTGGACTCATCTGCACGTAG

Full Affymetrix probeset data:

Annotations for 1638072_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720