FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638073_at:

>probe:Drosophila_2:1638073_at:409:471; Interrogation_Position=1006; Antisense; GTTCTACCACGATGTCTTGAAGATC
>probe:Drosophila_2:1638073_at:176:477; Interrogation_Position=1040; Antisense; GTTTATGAGTACGACTTCCCCAAGC
>probe:Drosophila_2:1638073_at:10:415; Interrogation_Position=1076; Antisense; GACCAGAAGTTCTTCCCGCTGAAGC
>probe:Drosophila_2:1638073_at:181:377; Interrogation_Position=1096; Antisense; GAAGCAGCCCTTCAATTTGTACATG
>probe:Drosophila_2:1638073_at:484:489; Interrogation_Position=1114; Antisense; GTACATGGACAAGCACCGCGATCAG
>probe:Drosophila_2:1638073_at:58:485; Interrogation_Position=1156; Antisense; GTATCTGGAGCGCAAGCTGGCCAAA
>probe:Drosophila_2:1638073_at:142:639; Interrogation_Position=1250; Antisense; TCGTGGCTGCGCACTGAGATTCGGA
>probe:Drosophila_2:1638073_at:713:141; Interrogation_Position=1289; Antisense; ACTGGTCGCGTGCAGGACTACTAGA
>probe:Drosophila_2:1638073_at:724:199; Interrogation_Position=813; Antisense; AACGCATGGTCTTTGTGCTCTACAA
>probe:Drosophila_2:1638073_at:655:451; Interrogation_Position=854; Antisense; GATCTCGGCTCTTATCAGTTGGCTG
>probe:Drosophila_2:1638073_at:17:727; Interrogation_Position=872; Antisense; TTGGCTGCTGCCGACTACGGTAATC
>probe:Drosophila_2:1638073_at:455:557; Interrogation_Position=922; Antisense; GGACTTCTATCGTCAGCACCAGGAG
>probe:Drosophila_2:1638073_at:365:33; Interrogation_Position=975; Antisense; ATCAGACCAACTGGGACGAGTCATT
>probe:Drosophila_2:1638073_at:454:431; Interrogation_Position=992; Antisense; GAGTCATTGACGCAGTTCTACCACG

Paste this into a BLAST search page for me
GTTCTACCACGATGTCTTGAAGATCGTTTATGAGTACGACTTCCCCAAGCGACCAGAAGTTCTTCCCGCTGAAGCGAAGCAGCCCTTCAATTTGTACATGGTACATGGACAAGCACCGCGATCAGGTATCTGGAGCGCAAGCTGGCCAAATCGTGGCTGCGCACTGAGATTCGGAACTGGTCGCGTGCAGGACTACTAGAAACGCATGGTCTTTGTGCTCTACAAGATCTCGGCTCTTATCAGTTGGCTGTTGGCTGCTGCCGACTACGGTAATCGGACTTCTATCGTCAGCACCAGGAGATCAGACCAACTGGGACGAGTCATTGAGTCATTGACGCAGTTCTACCACG

Full Affymetrix probeset data:

Annotations for 1638073_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720