Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638074_at:

>probe:Drosophila_2:1638074_at:577:639; Interrogation_Position=335; Antisense; TCGTGGAGTCGCTCATCATAGCAGA
>probe:Drosophila_2:1638074_at:657:235; Interrogation_Position=435; Antisense; AATCGAACGTTTTGCTCCAGTGGTC
>probe:Drosophila_2:1638074_at:164:85; Interrogation_Position=453; Antisense; AGTGGTCAGTGCCATTTATCCTGTG
>probe:Drosophila_2:1638074_at:699:683; Interrogation_Position=469; Antisense; TATCCTGTGCTGACTTGTAATCCCA
>probe:Drosophila_2:1638074_at:158:727; Interrogation_Position=483; Antisense; TTGTAATCCCAACGCTCCGAAAGAT
>probe:Drosophila_2:1638074_at:434:171; Interrogation_Position=502; Antisense; AAAGATGCCATACCGAACTTCGAGA
>probe:Drosophila_2:1638074_at:17:627; Interrogation_Position=579; Antisense; TGCCGGCCAGCACATTGGAATCGTG
>probe:Drosophila_2:1638074_at:557:53; Interrogation_Position=610; Antisense; ATGATTTGGCCTTGGTTCGAACGTT
>probe:Drosophila_2:1638074_at:281:469; Interrogation_Position=624; Antisense; GTTCGAACGTTTTCCCAGCATGAAG
>probe:Drosophila_2:1638074_at:373:423; Interrogation_Position=691; Antisense; GAGAAGCTGCTCAAGTGGCGCGATT
>probe:Drosophila_2:1638074_at:309:573; Interrogation_Position=707; Antisense; GGCGCGATTTGATGACCCAGGATGA
>probe:Drosophila_2:1638074_at:549:505; Interrogation_Position=757; Antisense; GTCCAGTTGCATGCTGAGTTCCAGA
>probe:Drosophila_2:1638074_at:524:707; Interrogation_Position=794; Antisense; TTGGAAATCCCCAGTACGACATTGC
>probe:Drosophila_2:1638074_at:409:561; Interrogation_Position=871; Antisense; GGAACCGGTTATGGACTGCATTTAT

Paste this into a BLAST search page for me
TCGTGGAGTCGCTCATCATAGCAGAAATCGAACGTTTTGCTCCAGTGGTCAGTGGTCAGTGCCATTTATCCTGTGTATCCTGTGCTGACTTGTAATCCCATTGTAATCCCAACGCTCCGAAAGATAAAGATGCCATACCGAACTTCGAGATGCCGGCCAGCACATTGGAATCGTGATGATTTGGCCTTGGTTCGAACGTTGTTCGAACGTTTTCCCAGCATGAAGGAGAAGCTGCTCAAGTGGCGCGATTGGCGCGATTTGATGACCCAGGATGAGTCCAGTTGCATGCTGAGTTCCAGATTGGAAATCCCCAGTACGACATTGCGGAACCGGTTATGGACTGCATTTAT

Full Affymetrix probeset data:

Annotations for 1638074_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime