Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638077_at:

>probe:Drosophila_2:1638077_at:482:723; Interrogation_Position=1307; Antisense; TTGCTTCGCTTTCCTATGGACAAGT
>probe:Drosophila_2:1638077_at:187:385; Interrogation_Position=1365; Antisense; GAACTACGCACCAAGGCTCGGAAAC
>probe:Drosophila_2:1638077_at:280:389; Interrogation_Position=1385; Antisense; GAAACAGTAGATCCGGCCTTGACAA
>probe:Drosophila_2:1638077_at:620:389; Interrogation_Position=1425; Antisense; GAAACCGACTCGAGAACCGTATGAA
>probe:Drosophila_2:1638077_at:255:363; Interrogation_Position=1447; Antisense; GAATTTCGCAAAGTACCCTATAGAG
>probe:Drosophila_2:1638077_at:690:189; Interrogation_Position=1472; Antisense; AAGTCCTACCTACTTCACCAAATGG
>probe:Drosophila_2:1638077_at:419:609; Interrogation_Position=1525; Antisense; TGACGAATGCTGTTTTAGTGCCCGA
>probe:Drosophila_2:1638077_at:318:27; Interrogation_Position=1578; Antisense; ATAGCTACATTTGGCAGTTTCTGTG
>probe:Drosophila_2:1638077_at:313:479; Interrogation_Position=1594; Antisense; GTTTCTGTGCTACCTACTGATAATA
>probe:Drosophila_2:1638077_at:253:369; Interrogation_Position=1624; Antisense; GAATGCTGCACTCCACAAAGTCGAG
>probe:Drosophila_2:1638077_at:281:511; Interrogation_Position=1656; Antisense; GTGAAGCTCTAGATCTGGCACTAAA
>probe:Drosophila_2:1638077_at:30:661; Interrogation_Position=1714; Antisense; TAACTTCTTGACTGCCTGTATACAC
>probe:Drosophila_2:1638077_at:215:265; Interrogation_Position=1769; Antisense; CAGAGCATTTTTGCGAATAGCCGGC
>probe:Drosophila_2:1638077_at:708:285; Interrogation_Position=1823; Antisense; CTGTCCGTGCGCCATAGCAATTAGA

Paste this into a BLAST search page for me
TTGCTTCGCTTTCCTATGGACAAGTGAACTACGCACCAAGGCTCGGAAACGAAACAGTAGATCCGGCCTTGACAAGAAACCGACTCGAGAACCGTATGAAGAATTTCGCAAAGTACCCTATAGAGAAGTCCTACCTACTTCACCAAATGGTGACGAATGCTGTTTTAGTGCCCGAATAGCTACATTTGGCAGTTTCTGTGGTTTCTGTGCTACCTACTGATAATAGAATGCTGCACTCCACAAAGTCGAGGTGAAGCTCTAGATCTGGCACTAAATAACTTCTTGACTGCCTGTATACACCAGAGCATTTTTGCGAATAGCCGGCCTGTCCGTGCGCCATAGCAATTAGA

Full Affymetrix probeset data:

Annotations for 1638077_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime