Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638078_at:

>probe:Drosophila_2:1638078_at:656:287; Interrogation_Position=1641; Antisense; CGGCGTCTCGATGTCGGAACTGAAG
>probe:Drosophila_2:1638078_at:534:361; Interrogation_Position=1683; Antisense; GCAATCCTCACCAAGATCCGAGAGT
>probe:Drosophila_2:1638078_at:430:45; Interrogation_Position=1698; Antisense; ATCCGAGAGTGGCATCGGTTCCAAT
>probe:Drosophila_2:1638078_at:510:495; Interrogation_Position=1775; Antisense; GTCAGGCTCTAAGGCAACGCCAGGA
>probe:Drosophila_2:1638078_at:286:77; Interrogation_Position=1802; Antisense; AGGAGTATCACTACATGGCCCAGGC
>probe:Drosophila_2:1638078_at:161:215; Interrogation_Position=1853; Antisense; AAGATGAGAGCATGTGGCGACCCTG
>probe:Drosophila_2:1638078_at:424:297; Interrogation_Position=1873; Antisense; CCCTGGTGAGCCGTTAGGTCAGAGA
>probe:Drosophila_2:1638078_at:557:537; Interrogation_Position=1889; Antisense; GGTCAGAGATCCTACGTACTAAGTA
>probe:Drosophila_2:1638078_at:401:479; Interrogation_Position=1911; Antisense; GTATGTAGACACCACCAGTTAGTTA
>probe:Drosophila_2:1638078_at:408:397; Interrogation_Position=1995; Antisense; GACACCTATTGTTATTACCGCTCGT
>probe:Drosophila_2:1638078_at:311:163; Interrogation_Position=2043; Antisense; AAATTGCATTTCCAACCTGTGCCAA
>probe:Drosophila_2:1638078_at:406:403; Interrogation_Position=2075; Antisense; GACTCTCTACAAGATGGGTTCCAGA
>probe:Drosophila_2:1638078_at:444:551; Interrogation_Position=2105; Antisense; GGAGAGCTACCCTTTCATTTATGTA
>probe:Drosophila_2:1638078_at:699:699; Interrogation_Position=2138; Antisense; TTTTTGCCCTGAACTCTGCGTTAAA

Paste this into a BLAST search page for me
CGGCGTCTCGATGTCGGAACTGAAGGCAATCCTCACCAAGATCCGAGAGTATCCGAGAGTGGCATCGGTTCCAATGTCAGGCTCTAAGGCAACGCCAGGAAGGAGTATCACTACATGGCCCAGGCAAGATGAGAGCATGTGGCGACCCTGCCCTGGTGAGCCGTTAGGTCAGAGAGGTCAGAGATCCTACGTACTAAGTAGTATGTAGACACCACCAGTTAGTTAGACACCTATTGTTATTACCGCTCGTAAATTGCATTTCCAACCTGTGCCAAGACTCTCTACAAGATGGGTTCCAGAGGAGAGCTACCCTTTCATTTATGTATTTTTGCCCTGAACTCTGCGTTAAA

Full Affymetrix probeset data:

Annotations for 1638078_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime