Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638079_at:

>probe:Drosophila_2:1638079_at:339:647; Interrogation_Position=1248; Antisense; TCAGCCCGCCTTTGTCGTGGACGAG
>probe:Drosophila_2:1638079_at:94:121; Interrogation_Position=1277; Antisense; AGCTGGGACATCTCAGTGCCGGATC
>probe:Drosophila_2:1638079_at:332:625; Interrogation_Position=1293; Antisense; TGCCGGATCGGGAGCCGCATCGAAC
>probe:Drosophila_2:1638079_at:487:299; Interrogation_Position=1325; Antisense; CGCTGGCTCTCTGGACGATTCTGGG
>probe:Drosophila_2:1638079_at:18:663; Interrogation_Position=1381; Antisense; TAAATCTCTCAAGGCGTGAACGACG
>probe:Drosophila_2:1638079_at:347:139; Interrogation_Position=1403; Antisense; ACGTGCGAGTGCGAGGAATGCTAAT
>probe:Drosophila_2:1638079_at:304:655; Interrogation_Position=1424; Antisense; TAATCAGGGCGGAATTGCGTGCAGT
>probe:Drosophila_2:1638079_at:642:27; Interrogation_Position=1498; Antisense; ATACCTATACTTGATGTAACTGCCA
>probe:Drosophila_2:1638079_at:614:491; Interrogation_Position=1513; Antisense; GTAACTGCCATTTACGGAACGTAAT
>probe:Drosophila_2:1638079_at:228:601; Interrogation_Position=1548; Antisense; TGTATGCATAGCGTAGGTTTTCAAC
>probe:Drosophila_2:1638079_at:76:541; Interrogation_Position=1563; Antisense; GGTTTTCAACGACTTATGGCAGCAG
>probe:Drosophila_2:1638079_at:628:67; Interrogation_Position=1578; Antisense; ATGGCAGCAGACATTGCGACAGAAA
>probe:Drosophila_2:1638079_at:284:107; Interrogation_Position=1712; Antisense; AGAACTCGGTCTAACTCATAAGCAC
>probe:Drosophila_2:1638079_at:89:31; Interrogation_Position=1729; Antisense; ATAAGCACCTACTAGTCTCCTAAGT

Paste this into a BLAST search page for me
TCAGCCCGCCTTTGTCGTGGACGAGAGCTGGGACATCTCAGTGCCGGATCTGCCGGATCGGGAGCCGCATCGAACCGCTGGCTCTCTGGACGATTCTGGGTAAATCTCTCAAGGCGTGAACGACGACGTGCGAGTGCGAGGAATGCTAATTAATCAGGGCGGAATTGCGTGCAGTATACCTATACTTGATGTAACTGCCAGTAACTGCCATTTACGGAACGTAATTGTATGCATAGCGTAGGTTTTCAACGGTTTTCAACGACTTATGGCAGCAGATGGCAGCAGACATTGCGACAGAAAAGAACTCGGTCTAACTCATAAGCACATAAGCACCTACTAGTCTCCTAAGT

Full Affymetrix probeset data:

Annotations for 1638079_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime