FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638080_at:

>probe:Drosophila_2:1638080_at:4:533; Interrogation_Position=1021; Antisense; GGTGAAATGCCAACTCAGACAGGAG
>probe:Drosophila_2:1638080_at:148:85; Interrogation_Position=1044; Antisense; AGTGTGGGAGCATATTCATGGCCAT
>probe:Drosophila_2:1638080_at:303:263; Interrogation_Position=1060; Antisense; CATGGCCATAAGGATTACGAATTCT
>probe:Drosophila_2:1638080_at:513:645; Interrogation_Position=1082; Antisense; TCTTCATGATGACCAGCTTTCTACC
>probe:Drosophila_2:1638080_at:53:593; Interrogation_Position=1109; Antisense; TGGTGGCTGCCATGAATACGAAAAC
>probe:Drosophila_2:1638080_at:76:463; Interrogation_Position=1147; Antisense; GATTCATTTTTTGATCCGCAAACGA
>probe:Drosophila_2:1638080_at:449:141; Interrogation_Position=1204; Antisense; ACGGATGTCAAGATGCTATTGCGAA
>probe:Drosophila_2:1638080_at:369:365; Interrogation_Position=742; Antisense; GAATATCGCACTAATCCGAAGCCAA
>probe:Drosophila_2:1638080_at:522:163; Interrogation_Position=765; Antisense; AAATAGGTACTACGTGCTGTGTCAC
>probe:Drosophila_2:1638080_at:179:119; Interrogation_Position=835; Antisense; ACAGGGTCTTTCGAGGACGTAATGC
>probe:Drosophila_2:1638080_at:465:695; Interrogation_Position=867; Antisense; TTTCCAGATCAGTAATGTTTGCCCC
>probe:Drosophila_2:1638080_at:571:409; Interrogation_Position=901; Antisense; GACCTAATTTACTCCATCTTCATGG
>probe:Drosophila_2:1638080_at:507:245; Interrogation_Position=970; Antisense; AATTATTATTTCTCTGTTCTGGCGG
>probe:Drosophila_2:1638080_at:611:285; Interrogation_Position=983; Antisense; CTGTTCTGGCGGACACTCTGAAAAA

Paste this into a BLAST search page for me
GGTGAAATGCCAACTCAGACAGGAGAGTGTGGGAGCATATTCATGGCCATCATGGCCATAAGGATTACGAATTCTTCTTCATGATGACCAGCTTTCTACCTGGTGGCTGCCATGAATACGAAAACGATTCATTTTTTGATCCGCAAACGAACGGATGTCAAGATGCTATTGCGAAGAATATCGCACTAATCCGAAGCCAAAAATAGGTACTACGTGCTGTGTCACACAGGGTCTTTCGAGGACGTAATGCTTTCCAGATCAGTAATGTTTGCCCCGACCTAATTTACTCCATCTTCATGGAATTATTATTTCTCTGTTCTGGCGGCTGTTCTGGCGGACACTCTGAAAAA

Full Affymetrix probeset data:

Annotations for 1638080_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720