FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638081_at:

>probe:Drosophila_2:1638081_at:358:721; Interrogation_Position=1088; Antisense; TTGCTGCAAATGTCCGAGAAACCTG
>probe:Drosophila_2:1638081_at:340:641; Interrogation_Position=602; Antisense; TCTGGCGGAGCTTCGTATATTCTGA
>probe:Drosophila_2:1638081_at:31:683; Interrogation_Position=617; Antisense; TATATTCTGAGTCGTGAGGCCCTAC
>probe:Drosophila_2:1638081_at:575:607; Interrogation_Position=631; Antisense; TGAGGCCCTACATCGATTTGCAACA
>probe:Drosophila_2:1638081_at:580:607; Interrogation_Position=670; Antisense; TGAGGTGATTTGTCCGCAGCCAAAA
>probe:Drosophila_2:1638081_at:350:109; Interrogation_Position=735; Antisense; AGAATGTGGGCGTCCACTTTGTCGA
>probe:Drosophila_2:1638081_at:131:159; Interrogation_Position=764; Antisense; ACACACGCTTTGGATGGAGACACGA
>probe:Drosophila_2:1638081_at:597:379; Interrogation_Position=787; Antisense; GAAGCCGAAGTTTATGCCCCTGGAT
>probe:Drosophila_2:1638081_at:249:705; Interrogation_Position=798; Antisense; TTATGCCCCTGGATCTGGAGAACTA
>probe:Drosophila_2:1638081_at:419:625; Interrogation_Position=858; Antisense; TGCGCCTCATGAGTCTATCTCGAGT
>probe:Drosophila_2:1638081_at:484:643; Interrogation_Position=875; Antisense; TCTCGAGTTGAAACGGGCTTGGCCT
>probe:Drosophila_2:1638081_at:68:255; Interrogation_Position=907; Antisense; CAACTACTCTGTGGCCTTTCATTAT
>probe:Drosophila_2:1638081_at:151:579; Interrogation_Position=919; Antisense; GGCCTTTCATTATGCCAGTCGAGAA
>probe:Drosophila_2:1638081_at:561:289; Interrogation_Position=944; Antisense; CGGATGTTCCTCTACGAGTTTCTAA

Paste this into a BLAST search page for me
TTGCTGCAAATGTCCGAGAAACCTGTCTGGCGGAGCTTCGTATATTCTGATATATTCTGAGTCGTGAGGCCCTACTGAGGCCCTACATCGATTTGCAACATGAGGTGATTTGTCCGCAGCCAAAAAGAATGTGGGCGTCCACTTTGTCGAACACACGCTTTGGATGGAGACACGAGAAGCCGAAGTTTATGCCCCTGGATTTATGCCCCTGGATCTGGAGAACTATGCGCCTCATGAGTCTATCTCGAGTTCTCGAGTTGAAACGGGCTTGGCCTCAACTACTCTGTGGCCTTTCATTATGGCCTTTCATTATGCCAGTCGAGAACGGATGTTCCTCTACGAGTTTCTAA

Full Affymetrix probeset data:

Annotations for 1638081_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720