Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638082_at:

>probe:Drosophila_2:1638082_at:160:283; Interrogation_Position=2259; Antisense; CTCCTCTACCCATGCGATGAAAAAC
>probe:Drosophila_2:1638082_at:112:313; Interrogation_Position=2294; Antisense; GCCACATTAATGACGCGGACTCGAT
>probe:Drosophila_2:1638082_at:381:557; Interrogation_Position=2310; Antisense; GGACTCGATGCGACGACCACTTTGG
>probe:Drosophila_2:1638082_at:436:675; Interrogation_Position=2340; Antisense; TAGGAAATTGCTGCGTTCGGCTGCT
>probe:Drosophila_2:1638082_at:490:5; Interrogation_Position=2371; Antisense; ATTCTGGTCTATCTGTTTTCCTTTT
>probe:Drosophila_2:1638082_at:205:703; Interrogation_Position=2414; Antisense; TTTTGTTGTTCCCATCTGCAGATAG
>probe:Drosophila_2:1638082_at:428:119; Interrogation_Position=2437; Antisense; AGCGACACAAAAACGGTTGCCTCCG
>probe:Drosophila_2:1638082_at:683:539; Interrogation_Position=2451; Antisense; GGTTGCCTCCGAGCCAAAGTCGAGC
>probe:Drosophila_2:1638082_at:357:219; Interrogation_Position=2467; Antisense; AAGTCGAGCTCGCTGCTGTGTTTGC
>probe:Drosophila_2:1638082_at:71:603; Interrogation_Position=2485; Antisense; TGTTTGCGAGCGTTTTCAGCGCATT
>probe:Drosophila_2:1638082_at:479:209; Interrogation_Position=2561; Antisense; AAGAAGTTGGCTACTCGCCTGGCGG
>probe:Drosophila_2:1638082_at:508:317; Interrogation_Position=2577; Antisense; GCCTGGCGGCTGGAAAAAGTCACAT
>probe:Drosophila_2:1638082_at:670:467; Interrogation_Position=2608; Antisense; GTTGTCTATACAACGCCTTTCTGGC
>probe:Drosophila_2:1638082_at:632:327; Interrogation_Position=2631; Antisense; GCGTGCTCTTTCGTGAAGTTGGCTA

Paste this into a BLAST search page for me
CTCCTCTACCCATGCGATGAAAAACGCCACATTAATGACGCGGACTCGATGGACTCGATGCGACGACCACTTTGGTAGGAAATTGCTGCGTTCGGCTGCTATTCTGGTCTATCTGTTTTCCTTTTTTTTGTTGTTCCCATCTGCAGATAGAGCGACACAAAAACGGTTGCCTCCGGGTTGCCTCCGAGCCAAAGTCGAGCAAGTCGAGCTCGCTGCTGTGTTTGCTGTTTGCGAGCGTTTTCAGCGCATTAAGAAGTTGGCTACTCGCCTGGCGGGCCTGGCGGCTGGAAAAAGTCACATGTTGTCTATACAACGCCTTTCTGGCGCGTGCTCTTTCGTGAAGTTGGCTA

Full Affymetrix probeset data:

Annotations for 1638082_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime