FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638085_at:

>probe:Drosophila_2:1638085_at:45:451; Interrogation_Position=471; Antisense; GATCGCAAGACAAACATTTACCTCA
>probe:Drosophila_2:1638085_at:435:611; Interrogation_Position=497; Antisense; TGAAATGTCCGCAAAGTCGAACTAT
>probe:Drosophila_2:1638085_at:659:107; Interrogation_Position=529; Antisense; AGAAGCCATTCGTCTATCTATTGCG
>probe:Drosophila_2:1638085_at:54:163; Interrogation_Position=555; Antisense; AAATTGGTGGGTGATCCCAGCCTGC
>probe:Drosophila_2:1638085_at:56:617; Interrogation_Position=577; Antisense; TGCAGTTAGTCCAGAGCCCCGCTAT
>probe:Drosophila_2:1638085_at:387:723; Interrogation_Position=616; Antisense; TTGTTTTTACCGACGAGATGAGCCG
>probe:Drosophila_2:1638085_at:189:319; Interrogation_Position=637; Antisense; GCCGTCAAGTGGAAAGCTTATTCAA
>probe:Drosophila_2:1638085_at:632:57; Interrogation_Position=661; Antisense; ATGAGGCCAAATCCAAACCTCTGCC
>probe:Drosophila_2:1638085_at:576:129; Interrogation_Position=677; Antisense; ACCTCTGCCCACTATTTACGATATT
>probe:Drosophila_2:1638085_at:335:245; Interrogation_Position=747; Antisense; AATTTTCATATTCTGCAAGTGCAAC
>probe:Drosophila_2:1638085_at:83:445; Interrogation_Position=772; Antisense; GATGATCTTTGCTTACTTTGTGCCC
>probe:Drosophila_2:1638085_at:676:595; Interrogation_Position=790; Antisense; TGTGCCCATGGATGAAGACATTCAG
>probe:Drosophila_2:1638085_at:546:617; Interrogation_Position=929; Antisense; TGCAGGCTCGGATTTATATTTCTAA
>probe:Drosophila_2:1638085_at:289:231; Interrogation_Position=960; Antisense; AATGTATCCCACTATATCTGTTATT

Paste this into a BLAST search page for me
GATCGCAAGACAAACATTTACCTCATGAAATGTCCGCAAAGTCGAACTATAGAAGCCATTCGTCTATCTATTGCGAAATTGGTGGGTGATCCCAGCCTGCTGCAGTTAGTCCAGAGCCCCGCTATTTGTTTTTACCGACGAGATGAGCCGGCCGTCAAGTGGAAAGCTTATTCAAATGAGGCCAAATCCAAACCTCTGCCACCTCTGCCCACTATTTACGATATTAATTTTCATATTCTGCAAGTGCAACGATGATCTTTGCTTACTTTGTGCCCTGTGCCCATGGATGAAGACATTCAGTGCAGGCTCGGATTTATATTTCTAAAATGTATCCCACTATATCTGTTATT

Full Affymetrix probeset data:

Annotations for 1638085_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720