FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638086_at:

>probe:Drosophila_2:1638086_at:68:587; Interrogation_Position=114; Antisense; TGGAGGATGGTCTGGTGCCCTTCAT
>probe:Drosophila_2:1638086_at:597:51; Interrogation_Position=147; Antisense; ATGCGTCGGAGAAGGTGACCCTGAT
>probe:Drosophila_2:1638086_at:220:189; Interrogation_Position=207; Antisense; AACAGGAACCATCCATCCGGTACTA
>probe:Drosophila_2:1638086_at:582:129; Interrogation_Position=248; Antisense; ACCTACAAGCTGTTGTGTCCACTGT
>probe:Drosophila_2:1638086_at:404:615; Interrogation_Position=314; Antisense; TGCAAGGACGCCAGTTTCTGCCTCA
>probe:Drosophila_2:1638086_at:260:515; Interrogation_Position=380; Antisense; GTGTGCACCTGGTGCGGTTGCAATC
>probe:Drosophila_2:1638086_at:454:465; Interrogation_Position=396; Antisense; GTTGCAATCGGGAGTGGACCACCAA
>probe:Drosophila_2:1638086_at:390:513; Interrogation_Position=409; Antisense; GTGGACCACCAAGGGCGTTTACTGC
>probe:Drosophila_2:1638086_at:551:707; Interrogation_Position=427; Antisense; TTACTGCAGCTCGTGTGGCGGCAAA
>probe:Drosophila_2:1638086_at:723:365; Interrogation_Position=456; Antisense; GAATCCAGCGCAAGGCCAAGTAGCC
>probe:Drosophila_2:1638086_at:589:269; Interrogation_Position=481; Antisense; CATCCCGCGGACCAATTAAATCGAA
>probe:Drosophila_2:1638086_at:499:11; Interrogation_Position=535; Antisense; ATTCTATTACGCGTCTAACTCAATT
>probe:Drosophila_2:1638086_at:100:383; Interrogation_Position=80; Antisense; GAACGTGCCAGGAATATTATTGCCA
>probe:Drosophila_2:1638086_at:638:15; Interrogation_Position=95; Antisense; ATTATTGCCAATGTGGTCCTGGAGG

Paste this into a BLAST search page for me
TGGAGGATGGTCTGGTGCCCTTCATATGCGTCGGAGAAGGTGACCCTGATAACAGGAACCATCCATCCGGTACTAACCTACAAGCTGTTGTGTCCACTGTTGCAAGGACGCCAGTTTCTGCCTCAGTGTGCACCTGGTGCGGTTGCAATCGTTGCAATCGGGAGTGGACCACCAAGTGGACCACCAAGGGCGTTTACTGCTTACTGCAGCTCGTGTGGCGGCAAAGAATCCAGCGCAAGGCCAAGTAGCCCATCCCGCGGACCAATTAAATCGAAATTCTATTACGCGTCTAACTCAATTGAACGTGCCAGGAATATTATTGCCAATTATTGCCAATGTGGTCCTGGAGG

Full Affymetrix probeset data:

Annotations for 1638086_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720