Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638087_at:

>probe:Drosophila_2:1638087_at:413:359; Interrogation_Position=187; Antisense; GCAACGATCATCTGTGGCTTCAAAG
>probe:Drosophila_2:1638087_at:321:59; Interrogation_Position=226; Antisense; ATGATCTCGACATGGAGACCTCCTT
>probe:Drosophila_2:1638087_at:581:103; Interrogation_Position=241; Antisense; AGACCTCCTTTAATTCGCTGTGGGA
>probe:Drosophila_2:1638087_at:73:595; Interrogation_Position=259; Antisense; TGTGGGAAACCTGTATCTTGCGTCA
>probe:Drosophila_2:1638087_at:145:435; Interrogation_Position=339; Antisense; GAGGGATCCGTGTTTGTGCACAACA
>probe:Drosophila_2:1638087_at:20:585; Interrogation_Position=374; Antisense; TGGCAAGCCGTTGTTGGTATTCCGC
>probe:Drosophila_2:1638087_at:716:539; Interrogation_Position=389; Antisense; GGTATTCCGCGTTAAGATGCACAGT
>probe:Drosophila_2:1638087_at:632:381; Interrogation_Position=432; Antisense; GAACTGATACGCATCGTGGTGTACT
>probe:Drosophila_2:1638087_at:13:101; Interrogation_Position=472; Antisense; AGAGGGAGCAGCATCTGACCCAGTT
>probe:Drosophila_2:1638087_at:396:609; Interrogation_Position=487; Antisense; TGACCCAGTTGACCATATTCTTCGA
>probe:Drosophila_2:1638087_at:456:687; Interrogation_Position=502; Antisense; TATTCTTCGACATGTCGGGCACGAG
>probe:Drosophila_2:1638087_at:621:125; Interrogation_Position=522; Antisense; ACGAGTTTGGCCTCCATGGATCTGG
>probe:Drosophila_2:1638087_at:618:401; Interrogation_Position=569; Antisense; GACATTTAAGCAGTTCTATCCCAAT
>probe:Drosophila_2:1638087_at:409:527; Interrogation_Position=655; Antisense; GGGAGTCATTTTTTCACTTTGAACA

Paste this into a BLAST search page for me
GCAACGATCATCTGTGGCTTCAAAGATGATCTCGACATGGAGACCTCCTTAGACCTCCTTTAATTCGCTGTGGGATGTGGGAAACCTGTATCTTGCGTCAGAGGGATCCGTGTTTGTGCACAACATGGCAAGCCGTTGTTGGTATTCCGCGGTATTCCGCGTTAAGATGCACAGTGAACTGATACGCATCGTGGTGTACTAGAGGGAGCAGCATCTGACCCAGTTTGACCCAGTTGACCATATTCTTCGATATTCTTCGACATGTCGGGCACGAGACGAGTTTGGCCTCCATGGATCTGGGACATTTAAGCAGTTCTATCCCAATGGGAGTCATTTTTTCACTTTGAACA

Full Affymetrix probeset data:

Annotations for 1638087_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime