FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638088_at:

>probe:Drosophila_2:1638088_at:407:273; Interrogation_Position=114; Antisense; CATTTCATCGAGTGTCCAAGCGGAT
>probe:Drosophila_2:1638088_at:207:647; Interrogation_Position=15; Antisense; TCAGTTATACTATACCGTCTCGCGT
>probe:Drosophila_2:1638088_at:110:387; Interrogation_Position=162; Antisense; GAACAACCAGGTGGTGGTCAGCCGC
>probe:Drosophila_2:1638088_at:409:537; Interrogation_Position=177; Antisense; GGTCAGCCGCCAGATTATGTGCATC
>probe:Drosophila_2:1638088_at:710:681; Interrogation_Position=192; Antisense; TATGTGCATCCTGGGCAAGAGCGAA
>probe:Drosophila_2:1638088_at:2:297; Interrogation_Position=219; Antisense; CGACCAACTGGGACTTCAACTCAAA
>probe:Drosophila_2:1638088_at:679:255; Interrogation_Position=240; Antisense; CAAAGCTGCCCTGCCAGAAGTTATA
>probe:Drosophila_2:1638088_at:521:27; Interrogation_Position=26; Antisense; ATACCGTCTCGCGTTCAGAAAGGAT
>probe:Drosophila_2:1638088_at:722:559; Interrogation_Position=269; Antisense; GGAAATGCAGGAACTGCTCCCCACA
>probe:Drosophila_2:1638088_at:390:119; Interrogation_Position=314; Antisense; AGCTGACCACATTTCTGCAAACTAG
>probe:Drosophila_2:1638088_at:39:147; Interrogation_Position=334; Antisense; ACTAGATACCCGGACGTATGGGCCA
>probe:Drosophila_2:1638088_at:505:485; Interrogation_Position=349; Antisense; GTATGGGCCATGCTTCTAAGGAAGT
>probe:Drosophila_2:1638088_at:312:559; Interrogation_Position=368; Antisense; GGAAGTACGACAGTGCCTAAATGGC
>probe:Drosophila_2:1638088_at:252:295; Interrogation_Position=70; Antisense; CGAGTGATTTCTTTGGTCGTTAATT

Paste this into a BLAST search page for me
CATTTCATCGAGTGTCCAAGCGGATTCAGTTATACTATACCGTCTCGCGTGAACAACCAGGTGGTGGTCAGCCGCGGTCAGCCGCCAGATTATGTGCATCTATGTGCATCCTGGGCAAGAGCGAACGACCAACTGGGACTTCAACTCAAACAAAGCTGCCCTGCCAGAAGTTATAATACCGTCTCGCGTTCAGAAAGGATGGAAATGCAGGAACTGCTCCCCACAAGCTGACCACATTTCTGCAAACTAGACTAGATACCCGGACGTATGGGCCAGTATGGGCCATGCTTCTAAGGAAGTGGAAGTACGACAGTGCCTAAATGGCCGAGTGATTTCTTTGGTCGTTAATT

Full Affymetrix probeset data:

Annotations for 1638088_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720