FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638091_at:

>probe:Drosophila_2:1638091_at:458:13; Interrogation_Position=2950; Antisense; ATTAGAAAGCTTAACCACCCCATCT
>probe:Drosophila_2:1638091_at:334:133; Interrogation_Position=2966; Antisense; ACCCCATCTCCTGGTGAAGCGAAAA
>probe:Drosophila_2:1638091_at:599:677; Interrogation_Position=2992; Antisense; TAGAGACTCCCCTTCAGTTGAATTA
>probe:Drosophila_2:1638091_at:397:421; Interrogation_Position=3041; Antisense; GAGAATGTAATACCCACCACTTCCT
>probe:Drosophila_2:1638091_at:220:255; Interrogation_Position=3055; Antisense; CACCACTTCCTTGGGTACTAGTAGT
>probe:Drosophila_2:1638091_at:660:197; Interrogation_Position=3133; Antisense; AACGTCTAGGGAAATGCGCTCGGTA
>probe:Drosophila_2:1638091_at:664:637; Interrogation_Position=3152; Antisense; TCGGTAGTCGAGTTCAATCTTGAGC
>probe:Drosophila_2:1638091_at:626:37; Interrogation_Position=3168; Antisense; ATCTTGAGCCTCTAAACAGACCGGA
>probe:Drosophila_2:1638091_at:606:125; Interrogation_Position=3193; Antisense; AGCCGAACTCGGACTGGATGCCGAA
>probe:Drosophila_2:1638091_at:290:193; Interrogation_Position=3216; Antisense; AACTCGGACCGGATCTCGAAGACGA
>probe:Drosophila_2:1638091_at:273:45; Interrogation_Position=3247; Antisense; ATCCGAACTTTTGCTCTGGCCAGAA
>probe:Drosophila_2:1638091_at:418:579; Interrogation_Position=3263; Antisense; TGGCCAGAACGGGAGTCCTTTATCC
>probe:Drosophila_2:1638091_at:501:545; Interrogation_Position=3347; Antisense; GGATCGCATTCTTCTAAAAGGCCTA
>probe:Drosophila_2:1638091_at:68:573; Interrogation_Position=3419; Antisense; GGCTCCGTGAGCAAGAACCATATCC

Paste this into a BLAST search page for me
ATTAGAAAGCTTAACCACCCCATCTACCCCATCTCCTGGTGAAGCGAAAATAGAGACTCCCCTTCAGTTGAATTAGAGAATGTAATACCCACCACTTCCTCACCACTTCCTTGGGTACTAGTAGTAACGTCTAGGGAAATGCGCTCGGTATCGGTAGTCGAGTTCAATCTTGAGCATCTTGAGCCTCTAAACAGACCGGAAGCCGAACTCGGACTGGATGCCGAAAACTCGGACCGGATCTCGAAGACGAATCCGAACTTTTGCTCTGGCCAGAATGGCCAGAACGGGAGTCCTTTATCCGGATCGCATTCTTCTAAAAGGCCTAGGCTCCGTGAGCAAGAACCATATCC

Full Affymetrix probeset data:

Annotations for 1638091_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720