Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638092_a_at:

>probe:Drosophila_2:1638092_a_at:266:87; Interrogation_Position=230; Antisense; AGTCCGACGTGGATCGCGTGCTCAT
>probe:Drosophila_2:1638092_a_at:695:507; Interrogation_Position=247; Antisense; GTGCTCATCTATGTGACGCTCTACA
>probe:Drosophila_2:1638092_a_at:299:411; Interrogation_Position=261; Antisense; GACGCTCTACATAACAGAGTGCCTC
>probe:Drosophila_2:1638092_a_at:692:431; Interrogation_Position=277; Antisense; GAGTGCCTCAAGAAGCTCAATCGCT
>probe:Drosophila_2:1638092_a_at:385:251; Interrogation_Position=309; Antisense; CAAGGCCCAGGGACAGCAGGACATG
>probe:Drosophila_2:1638092_a_at:145:75; Interrogation_Position=326; Antisense; AGGACATGTACAGCCTGGCCATCTC
>probe:Drosophila_2:1638092_a_at:267:217; Interrogation_Position=352; Antisense; AAGTTCGACATTCCCGGCGATGCTG
>probe:Drosophila_2:1638092_a_at:275:575; Interrogation_Position=367; Antisense; GGCGATGCTGGCTTCCCATTGAACG
>probe:Drosophila_2:1638092_a_at:205:5; Interrogation_Position=384; Antisense; ATTGAACGCCGTCTATGCCAAGCCG
>probe:Drosophila_2:1638092_a_at:588:141; Interrogation_Position=412; Antisense; ACGGCCCAGGATGCGGATCTGATGC
>probe:Drosophila_2:1638092_a_at:708:39; Interrogation_Position=428; Antisense; ATCTGATGCGCCAGTACCTGCTGCA
>probe:Drosophila_2:1638092_a_at:660:617; Interrogation_Position=449; Antisense; TGCAGCTGCGCCACGAAACCGGCAA
>probe:Drosophila_2:1638092_a_at:510:223; Interrogation_Position=487; Antisense; AAGGTCTTCAACACCGAGGATGGCA
>probe:Drosophila_2:1638092_a_at:323:229; Interrogation_Position=521; Antisense; AATGGTGGACCTGCTTCGCGAAGAA

Paste this into a BLAST search page for me
AGTCCGACGTGGATCGCGTGCTCATGTGCTCATCTATGTGACGCTCTACAGACGCTCTACATAACAGAGTGCCTCGAGTGCCTCAAGAAGCTCAATCGCTCAAGGCCCAGGGACAGCAGGACATGAGGACATGTACAGCCTGGCCATCTCAAGTTCGACATTCCCGGCGATGCTGGGCGATGCTGGCTTCCCATTGAACGATTGAACGCCGTCTATGCCAAGCCGACGGCCCAGGATGCGGATCTGATGCATCTGATGCGCCAGTACCTGCTGCATGCAGCTGCGCCACGAAACCGGCAAAAGGTCTTCAACACCGAGGATGGCAAATGGTGGACCTGCTTCGCGAAGAA

Full Affymetrix probeset data:

Annotations for 1638092_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime