FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638094_at:

>probe:Drosophila_2:1638094_at:176:199; Interrogation_Position=1022; Antisense; AAGCGGGAGTCCGTATGACCGCCAA
>probe:Drosophila_2:1638094_at:360:337; Interrogation_Position=1061; Antisense; GCTCCACGCTCCTCGAGGAAATGAT
>probe:Drosophila_2:1638094_at:495:165; Interrogation_Position=1079; Antisense; AAATGATCCGCCTGAAACTGGTGCC
>probe:Drosophila_2:1638094_at:147:391; Interrogation_Position=1092; Antisense; GAAACTGGTGCCCAAGCCGAACAAA
>probe:Drosophila_2:1638094_at:449:233; Interrogation_Position=618; Antisense; AATGCCGGGAGATATCCACAAGCGA
>probe:Drosophila_2:1638094_at:697:23; Interrogation_Position=655; Antisense; ATAGTCTCGCGGTCGGGAACCCTGA
>probe:Drosophila_2:1638094_at:505:505; Interrogation_Position=691; Antisense; GTCCATCAGACCACCAACGTGGGAT
>probe:Drosophila_2:1638094_at:706:1; Interrogation_Position=714; Antisense; ATTGGGTCAGGCTCTTTGCGTTGGC
>probe:Drosophila_2:1638094_at:479:675; Interrogation_Position=765; Antisense; TAGCTTCATAGACGCCCTCAAAGTG
>probe:Drosophila_2:1638094_at:730:305; Interrogation_Position=780; Antisense; CCTCAAAGTGTTTCTGTCCGACAAG
>probe:Drosophila_2:1638094_at:503:213; Interrogation_Position=854; Antisense; AAGAGGCTGCCGATTTCCTTAAGGA
>probe:Drosophila_2:1638094_at:553:211; Interrogation_Position=880; Antisense; AAGAACACTGGCTGCGAGGCCAAGC
>probe:Drosophila_2:1638094_at:266:467; Interrogation_Position=910; Antisense; GTTGGCTTCATTGCTGGACAGACTG
>probe:Drosophila_2:1638094_at:163:619; Interrogation_Position=933; Antisense; TGCTCCACCGGGTCGTCGAATGGGT

Paste this into a BLAST search page for me
AAGCGGGAGTCCGTATGACCGCCAAGCTCCACGCTCCTCGAGGAAATGATAAATGATCCGCCTGAAACTGGTGCCGAAACTGGTGCCCAAGCCGAACAAAAATGCCGGGAGATATCCACAAGCGAATAGTCTCGCGGTCGGGAACCCTGAGTCCATCAGACCACCAACGTGGGATATTGGGTCAGGCTCTTTGCGTTGGCTAGCTTCATAGACGCCCTCAAAGTGCCTCAAAGTGTTTCTGTCCGACAAGAAGAGGCTGCCGATTTCCTTAAGGAAAGAACACTGGCTGCGAGGCCAAGCGTTGGCTTCATTGCTGGACAGACTGTGCTCCACCGGGTCGTCGAATGGGT

Full Affymetrix probeset data:

Annotations for 1638094_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720