FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638095_at:

>probe:Drosophila_2:1638095_at:423:591; Interrogation_Position=1135; Antisense; TGGTGTCTATACATCACCTCCAAGT
>probe:Drosophila_2:1638095_at:255:129; Interrogation_Position=1150; Antisense; ACCTCCAAGTCGTGCCCAGAGAAGA
>probe:Drosophila_2:1638095_at:699:211; Interrogation_Position=1209; Antisense; AAGAAATTCTATCGCGCTCTTTGTG
>probe:Drosophila_2:1638095_at:353:277; Interrogation_Position=1227; Antisense; CTTTGTGCCCTGCAAGAACCAGTAT
>probe:Drosophila_2:1638095_at:94:27; Interrogation_Position=1314; Antisense; ATACGAGTTCTTCATCGTCGTCCAT
>probe:Drosophila_2:1638095_at:634:153; Interrogation_Position=1342; Antisense; ACACGCGTCCCAGAACAATTTACAG
>probe:Drosophila_2:1638095_at:607:247; Interrogation_Position=1357; Antisense; CAATTTACAGTGTCACCGCCAAGGT
>probe:Drosophila_2:1638095_at:510:259; Interrogation_Position=1370; Antisense; CACCGCCAAGGTGCATCGTGGAAAT
>probe:Drosophila_2:1638095_at:396:559; Interrogation_Position=1389; Antisense; GGAAATCCAAAAGCCTTGATCATCG
>probe:Drosophila_2:1638095_at:407:647; Interrogation_Position=1408; Antisense; TCATCGATATTGTCACTCAAGCGGG
>probe:Drosophila_2:1638095_at:55:365; Interrogation_Position=1461; Antisense; GAATTTGGTAGGACCACGCCATCAT
>probe:Drosophila_2:1638095_at:541:133; Interrogation_Position=1476; Antisense; ACGCCATCATTGTCCTCTATTATAG
>probe:Drosophila_2:1638095_at:544:175; Interrogation_Position=1503; Antisense; AAACCCATGGATATTCAAGCTCTAG
>probe:Drosophila_2:1638095_at:55:43; Interrogation_Position=1539; Antisense; ATCGATTTAGATTGGCCACATGAAG

Paste this into a BLAST search page for me
TGGTGTCTATACATCACCTCCAAGTACCTCCAAGTCGTGCCCAGAGAAGAAAGAAATTCTATCGCGCTCTTTGTGCTTTGTGCCCTGCAAGAACCAGTATATACGAGTTCTTCATCGTCGTCCATACACGCGTCCCAGAACAATTTACAGCAATTTACAGTGTCACCGCCAAGGTCACCGCCAAGGTGCATCGTGGAAATGGAAATCCAAAAGCCTTGATCATCGTCATCGATATTGTCACTCAAGCGGGGAATTTGGTAGGACCACGCCATCATACGCCATCATTGTCCTCTATTATAGAAACCCATGGATATTCAAGCTCTAGATCGATTTAGATTGGCCACATGAAG

Full Affymetrix probeset data:

Annotations for 1638095_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720