FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638096_at:

>probe:Drosophila_2:1638096_at:261:519; Interrogation_Position=196; Antisense; GTGGTAACGCTCTTTGCCAGCATAA
>probe:Drosophila_2:1638096_at:71:117; Interrogation_Position=214; Antisense; AGCATAAATCTCTGCACCGGTCATC
>probe:Drosophila_2:1638096_at:477:537; Interrogation_Position=232; Antisense; GGTCATCGCACATCGATCGTTGAGG
>probe:Drosophila_2:1638096_at:230:375; Interrogation_Position=256; Antisense; GAAGTTGTGCGTCCTCTGATCGGAT
>probe:Drosophila_2:1638096_at:542:225; Interrogation_Position=354; Antisense; AAGGAACCCGGATGATTTACTATAT
>probe:Drosophila_2:1638096_at:2:157; Interrogation_Position=427; Antisense; ACAGCCTCATTGGTGTCCAGTGTTA
>probe:Drosophila_2:1638096_at:368:85; Interrogation_Position=445; Antisense; AGTGTTATCTATCTGCTGCACTGCC
>probe:Drosophila_2:1638096_at:401:617; Interrogation_Position=461; Antisense; TGCACTGCCTCATTGCGTTGGATGT
>probe:Drosophila_2:1638096_at:507:465; Interrogation_Position=477; Antisense; GTTGGATGTCCTTCTGTCGAATGAC
>probe:Drosophila_2:1638096_at:616:659; Interrogation_Position=510; Antisense; TAACGAACGCGAGTCATCCAATTCC
>probe:Drosophila_2:1638096_at:201:245; Interrogation_Position=529; Antisense; AATTCCTCCGACGATGTGAACGAAG
>probe:Drosophila_2:1638096_at:506:375; Interrogation_Position=550; Antisense; GAAGAGGTCGACTACGTTCCAGTGC
>probe:Drosophila_2:1638096_at:464:477; Interrogation_Position=627; Antisense; GTTTCAGGACTTTACCCACAGTGGA
>probe:Drosophila_2:1638096_at:409:421; Interrogation_Position=67; Antisense; GAGACGACGGCCAACTTATTCGTTT

Paste this into a BLAST search page for me
GTGGTAACGCTCTTTGCCAGCATAAAGCATAAATCTCTGCACCGGTCATCGGTCATCGCACATCGATCGTTGAGGGAAGTTGTGCGTCCTCTGATCGGATAAGGAACCCGGATGATTTACTATATACAGCCTCATTGGTGTCCAGTGTTAAGTGTTATCTATCTGCTGCACTGCCTGCACTGCCTCATTGCGTTGGATGTGTTGGATGTCCTTCTGTCGAATGACTAACGAACGCGAGTCATCCAATTCCAATTCCTCCGACGATGTGAACGAAGGAAGAGGTCGACTACGTTCCAGTGCGTTTCAGGACTTTACCCACAGTGGAGAGACGACGGCCAACTTATTCGTTT

Full Affymetrix probeset data:

Annotations for 1638096_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720