FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638097_at:

>probe:Drosophila_2:1638097_at:55:161; Interrogation_Position=152; Antisense; ACAAGGGCATCGTGGGCTTCAATCA
>probe:Drosophila_2:1638097_at:476:445; Interrogation_Position=219; Antisense; GATGAAGAACGCCTCGCAGTTCGGC
>probe:Drosophila_2:1638097_at:355:161; Interrogation_Position=248; Antisense; ACAAGTGCAAGGTGGCCAATCCGCT
>probe:Drosophila_2:1638097_at:400:513; Interrogation_Position=289; Antisense; GTGATCAAGCTGAGGCCAGGGCCTA
>probe:Drosophila_2:1638097_at:364:131; Interrogation_Position=324; Antisense; ACCGCGGCGGTTCCAACTGAAGAAG
>probe:Drosophila_2:1638097_at:177:547; Interrogation_Position=389; Antisense; GGATGAGCAACGTGTCCGACGAAAT
>probe:Drosophila_2:1638097_at:17:167; Interrogation_Position=410; Antisense; AAATGCAGATCTACGGTTACCGGGT
>probe:Drosophila_2:1638097_at:647:671; Interrogation_Position=427; Antisense; TACCGGGTGGCCTACATGAGTGACA
>probe:Drosophila_2:1638097_at:497:385; Interrogation_Position=549; Antisense; GAACACCACGTATCTGATGCGGGCG
>probe:Drosophila_2:1638097_at:597:237; Interrogation_Position=583; Antisense; AATCTGGCCGGATTGAGCGACTGGA
>probe:Drosophila_2:1638097_at:654:405; Interrogation_Position=601; Antisense; GACTGGAGTCCCGTGAAGGTGTTCA
>probe:Drosophila_2:1638097_at:509:223; Interrogation_Position=616; Antisense; AAGGTGTTCACCACGGCCGCAGGAT
>probe:Drosophila_2:1638097_at:712:431; Interrogation_Position=648; Antisense; GAGTCCTTGGCTGTATCCGTCATAT
>probe:Drosophila_2:1638097_at:67:25; Interrogation_Position=669; Antisense; ATATGGACTCATTCTCGCTTTGATC

Paste this into a BLAST search page for me
ACAAGGGCATCGTGGGCTTCAATCAGATGAAGAACGCCTCGCAGTTCGGCACAAGTGCAAGGTGGCCAATCCGCTGTGATCAAGCTGAGGCCAGGGCCTAACCGCGGCGGTTCCAACTGAAGAAGGGATGAGCAACGTGTCCGACGAAATAAATGCAGATCTACGGTTACCGGGTTACCGGGTGGCCTACATGAGTGACAGAACACCACGTATCTGATGCGGGCGAATCTGGCCGGATTGAGCGACTGGAGACTGGAGTCCCGTGAAGGTGTTCAAAGGTGTTCACCACGGCCGCAGGATGAGTCCTTGGCTGTATCCGTCATATATATGGACTCATTCTCGCTTTGATC

Full Affymetrix probeset data:

Annotations for 1638097_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720