FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638098_at:

>probe:Drosophila_2:1638098_at:84:549; Interrogation_Position=258; Antisense; GGAGTGGATATTGACTGCCGCCCAT
>probe:Drosophila_2:1638098_at:657:625; Interrogation_Position=273; Antisense; TGCCGCCCATTGCACATATGGTAAA
>probe:Drosophila_2:1638098_at:71:87; Interrogation_Position=315; Antisense; AGTGCGACTCGGAACCAGCGAATTT
>probe:Drosophila_2:1638098_at:547:363; Interrogation_Position=334; Antisense; GAATTTGCTCGCAGTGGCCAACTTC
>probe:Drosophila_2:1638098_at:235:229; Interrogation_Position=403; Antisense; AATGTGGACTACGATTTCTCGCTGC
>probe:Drosophila_2:1638098_at:489:673; Interrogation_Position=434; Antisense; TAGCTCATCCCATCAAGTTTGACGA
>probe:Drosophila_2:1638098_at:645:207; Interrogation_Position=475; Antisense; AAGCTGCCCGAGTCTCAGATGAAAT
>probe:Drosophila_2:1638098_at:727:107; Interrogation_Position=545; Antisense; AGAACCTGCTGGAGTCCCGCGAGTG
>probe:Drosophila_2:1638098_at:591:79; Interrogation_Position=584; Antisense; AGGTGCCTCTGGTCAATCAGGAGCT
>probe:Drosophila_2:1638098_at:86:491; Interrogation_Position=621; Antisense; GTACAAACAGTACGGCGGCGTCACC
>probe:Drosophila_2:1638098_at:254:289; Interrogation_Position=636; Antisense; CGGCGTCACCGAGCGAATGATCTGT
>probe:Drosophila_2:1638098_at:327:231; Interrogation_Position=651; Antisense; AATGATCTGTGCTGGATTTCTGGAA
>probe:Drosophila_2:1638098_at:480:303; Interrogation_Position=704; Antisense; CCGGCGGTCCGATGGTCAGTGAATC
>probe:Drosophila_2:1638098_at:467:643; Interrogation_Position=796; Antisense; TCAAGAGTAAGTTTCGCACGGGATT

Paste this into a BLAST search page for me
GGAGTGGATATTGACTGCCGCCCATTGCCGCCCATTGCACATATGGTAAAAGTGCGACTCGGAACCAGCGAATTTGAATTTGCTCGCAGTGGCCAACTTCAATGTGGACTACGATTTCTCGCTGCTAGCTCATCCCATCAAGTTTGACGAAAGCTGCCCGAGTCTCAGATGAAATAGAACCTGCTGGAGTCCCGCGAGTGAGGTGCCTCTGGTCAATCAGGAGCTGTACAAACAGTACGGCGGCGTCACCCGGCGTCACCGAGCGAATGATCTGTAATGATCTGTGCTGGATTTCTGGAACCGGCGGTCCGATGGTCAGTGAATCTCAAGAGTAAGTTTCGCACGGGATT

Full Affymetrix probeset data:

Annotations for 1638098_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720