Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638103_at:

>probe:Drosophila_2:1638103_at:136:641; Interrogation_Position=1617; Antisense; TCTCTGGTTCCTGTGAATACTTGGA
>probe:Drosophila_2:1638103_at:260:363; Interrogation_Position=1631; Antisense; GAATACTTGGATTTTCTTCCGCCGG
>probe:Drosophila_2:1638103_at:652:365; Interrogation_Position=1660; Antisense; GAATCCGGCTCGACCTCTTGTTGGT
>probe:Drosophila_2:1638103_at:81:145; Interrogation_Position=1705; Antisense; ACTGCTTTCTGCTTGTCCACGGAGA
>probe:Drosophila_2:1638103_at:264:505; Interrogation_Position=1719; Antisense; GTCCACGGAGATTTTTGTCTCGCCT
>probe:Drosophila_2:1638103_at:534:599; Interrogation_Position=1734; Antisense; TGTCTCGCCTTTAATGATAGCCATT
>probe:Drosophila_2:1638103_at:440:457; Interrogation_Position=1749; Antisense; GATAGCCATTCCACCAAGGCGACGA
>probe:Drosophila_2:1638103_at:116:227; Interrogation_Position=1764; Antisense; AAGGCGACGACATCTGAAGGACCAT
>probe:Drosophila_2:1638103_at:188:431; Interrogation_Position=1803; Antisense; GAGTCCCAGCTTAAGCATTGCTTGG
>probe:Drosophila_2:1638103_at:220:565; Interrogation_Position=1854; Antisense; GGAATTTATTCTACATTTGCCAGTT
>probe:Drosophila_2:1638103_at:677:661; Interrogation_Position=1927; Antisense; TAAACAGTGCGTTTCGCCGATGTAA
>probe:Drosophila_2:1638103_at:417:567; Interrogation_Position=1967; Antisense; GGCAGTTCGTTTTCTAAATCCAAAG
>probe:Drosophila_2:1638103_at:699:361; Interrogation_Position=2013; Antisense; GCAATAGTTCTATGGCCTGGAAACA
>probe:Drosophila_2:1638103_at:329:535; Interrogation_Position=2160; Antisense; GGTCCAATTATCACATACTTTTTGT

Paste this into a BLAST search page for me
TCTCTGGTTCCTGTGAATACTTGGAGAATACTTGGATTTTCTTCCGCCGGGAATCCGGCTCGACCTCTTGTTGGTACTGCTTTCTGCTTGTCCACGGAGAGTCCACGGAGATTTTTGTCTCGCCTTGTCTCGCCTTTAATGATAGCCATTGATAGCCATTCCACCAAGGCGACGAAAGGCGACGACATCTGAAGGACCATGAGTCCCAGCTTAAGCATTGCTTGGGGAATTTATTCTACATTTGCCAGTTTAAACAGTGCGTTTCGCCGATGTAAGGCAGTTCGTTTTCTAAATCCAAAGGCAATAGTTCTATGGCCTGGAAACAGGTCCAATTATCACATACTTTTTGT

Full Affymetrix probeset data:

Annotations for 1638103_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime