Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638104_a_at:

>probe:Drosophila_2:1638104_a_at:165:307; Interrogation_Position=1083; Antisense; CCAGTTCCGGGCTGTTAAGTTCATG
>probe:Drosophila_2:1638104_a_at:262:345; Interrogation_Position=1115; Antisense; GCATTCCTGGCGAGCATTTGTGCAT
>probe:Drosophila_2:1638104_a_at:182:79; Interrogation_Position=1145; Antisense; AGGTCACCAGGTACTTGGCATCATC
>probe:Drosophila_2:1638104_a_at:514:583; Interrogation_Position=1160; Antisense; TGGCATCATCATGACTCGTGCAATA
>probe:Drosophila_2:1638104_a_at:442:285; Interrogation_Position=703; Antisense; CTGTGCCTAGCTACGGATATCAATC
>probe:Drosophila_2:1638104_a_at:572:173; Interrogation_Position=730; Antisense; AAAGCCTGCAATGCCACTCGAAGAA
>probe:Drosophila_2:1638104_a_at:327:371; Interrogation_Position=765; Antisense; GAATGGCGCTCGCTTGGATAGCATT
>probe:Drosophila_2:1638104_a_at:659:727; Interrogation_Position=778; Antisense; TTGGATAGCATTCGCTGCAGCCTAG
>probe:Drosophila_2:1638104_a_at:5:47; Interrogation_Position=845; Antisense; ATCCGCCCTATGTAGTCACCAGTGA
>probe:Drosophila_2:1638104_a_at:592:103; Interrogation_Position=881; Antisense; AGACGCAACAGTTCGATTCGCACAG
>probe:Drosophila_2:1638104_a_at:332:719; Interrogation_Position=897; Antisense; TTCGCACAGCGAATCCTCAACGGAT
>probe:Drosophila_2:1638104_a_at:644:253; Interrogation_Position=914; Antisense; CAACGGATCGCAATCTGGTTTTCTC
>probe:Drosophila_2:1638104_a_at:2:495; Interrogation_Position=967; Antisense; GTCACGGACATTCTACTCAAGCAAT
>probe:Drosophila_2:1638104_a_at:529:247; Interrogation_Position=989; Antisense; AATTGGATGACATTCTTTCGCCTCG

Paste this into a BLAST search page for me
CCAGTTCCGGGCTGTTAAGTTCATGGCATTCCTGGCGAGCATTTGTGCATAGGTCACCAGGTACTTGGCATCATCTGGCATCATCATGACTCGTGCAATACTGTGCCTAGCTACGGATATCAATCAAAGCCTGCAATGCCACTCGAAGAAGAATGGCGCTCGCTTGGATAGCATTTTGGATAGCATTCGCTGCAGCCTAGATCCGCCCTATGTAGTCACCAGTGAAGACGCAACAGTTCGATTCGCACAGTTCGCACAGCGAATCCTCAACGGATCAACGGATCGCAATCTGGTTTTCTCGTCACGGACATTCTACTCAAGCAATAATTGGATGACATTCTTTCGCCTCG

Full Affymetrix probeset data:

Annotations for 1638104_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime