FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638105_at:

>probe:Drosophila_2:1638105_at:17:229; Interrogation_Position=1041; Antisense; AAGGCCAGCTCCCAAAGCGGTGACA
>probe:Drosophila_2:1638105_at:326:305; Interrogation_Position=1072; Antisense; CCGGTGGCACCGAATTGGAGCATGA
>probe:Drosophila_2:1638105_at:200:409; Interrogation_Position=1146; Antisense; GACGAACTGAGCCTGAGTTACTCGC
>probe:Drosophila_2:1638105_at:586:429; Interrogation_Position=1160; Antisense; GAGTTACTCGCAGTTGAGCAGCAGT
>probe:Drosophila_2:1638105_at:27:205; Interrogation_Position=1195; Antisense; AAGCCGAAGCTCCACCAGAAGATGT
>probe:Drosophila_2:1638105_at:374:99; Interrogation_Position=1214; Antisense; AGATGTTCCTGATGATCGACAAGCA
>probe:Drosophila_2:1638105_at:607:133; Interrogation_Position=1273; Antisense; ACGTTGCCAATGAGCGGCGACGCAA
>probe:Drosophila_2:1638105_at:663:295; Interrogation_Position=1351; Antisense; GCGACATTACGCTGGTGGACGATAC
>probe:Drosophila_2:1638105_at:140:557; Interrogation_Position=1367; Antisense; GGACGATACCTACTCCAACTACGAT
>probe:Drosophila_2:1638105_at:507:181; Interrogation_Position=1396; Antisense; AAAACGATGCCGAGCGCATGTTCCT
>probe:Drosophila_2:1638105_at:693:347; Interrogation_Position=1411; Antisense; GCATGTTCCTCCAGGTTGTCGGAAT
>probe:Drosophila_2:1638105_at:273:335; Interrogation_Position=1481; Antisense; GCTGAAATATTGGTCACGCCTATAA
>probe:Drosophila_2:1638105_at:93:363; Interrogation_Position=943; Antisense; GCAATGAGTCGCACCACTTTGGCAA
>probe:Drosophila_2:1638105_at:405:657; Interrogation_Position=960; Antisense; TTTGGCAACCATCTCAACAACCTGG

Paste this into a BLAST search page for me
AAGGCCAGCTCCCAAAGCGGTGACACCGGTGGCACCGAATTGGAGCATGAGACGAACTGAGCCTGAGTTACTCGCGAGTTACTCGCAGTTGAGCAGCAGTAAGCCGAAGCTCCACCAGAAGATGTAGATGTTCCTGATGATCGACAAGCAACGTTGCCAATGAGCGGCGACGCAAGCGACATTACGCTGGTGGACGATACGGACGATACCTACTCCAACTACGATAAAACGATGCCGAGCGCATGTTCCTGCATGTTCCTCCAGGTTGTCGGAATGCTGAAATATTGGTCACGCCTATAAGCAATGAGTCGCACCACTTTGGCAATTTGGCAACCATCTCAACAACCTGG

Full Affymetrix probeset data:

Annotations for 1638105_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720