FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638107_at:

>probe:Drosophila_2:1638107_at:484:527; Interrogation_Position=392; Antisense; GGGACGATCAGGAACGCTTCGATAA
>probe:Drosophila_2:1638107_at:342:661; Interrogation_Position=414; Antisense; TAACGAGCAGTACCATCCGCGCGAA
>probe:Drosophila_2:1638107_at:471:227; Interrogation_Position=450; Antisense; CAAGTACGAGTGCACCTGGGTTAAT
>probe:Drosophila_2:1638107_at:705:649; Interrogation_Position=471; Antisense; TAATTTCCCGGACAGTGTGGCGACC
>probe:Drosophila_2:1638107_at:205:237; Interrogation_Position=502; Antisense; AATCGTAGACGGGACTTTCTGGAGT
>probe:Drosophila_2:1638107_at:442:439; Interrogation_Position=528; Antisense; GATGGAAACTGAGGCTCCTCGACGC
>probe:Drosophila_2:1638107_at:592:203; Interrogation_Position=586; Antisense; AAGCCATGTGACGACGAGGCCCGTG
>probe:Drosophila_2:1638107_at:303:301; Interrogation_Position=606; Antisense; CCGTGCCTTTATCAACCAATGGGAC
>probe:Drosophila_2:1638107_at:61:65; Interrogation_Position=624; Antisense; ATGGGACACCAATGCGGCGATGATC
>probe:Drosophila_2:1638107_at:442:187; Interrogation_Position=655; Antisense; AACAAATTTGCTCGTGCCACCGATA
>probe:Drosophila_2:1638107_at:717:273; Interrogation_Position=693; Antisense; CATTGTATCTCTCCGGTTGTCAAAC
>probe:Drosophila_2:1638107_at:358:153; Interrogation_Position=722; Antisense; ACAGCACCCGAAAACGTCAGTTCTT
>probe:Drosophila_2:1638107_at:625:235; Interrogation_Position=797; Antisense; AATCGCTCATTCTTGTAGCCTGATC
>probe:Drosophila_2:1638107_at:58:73; Interrogation_Position=838; Antisense; AGGCATCAGATTTTAAAGCGTCCAA

Paste this into a BLAST search page for me
GGGACGATCAGGAACGCTTCGATAATAACGAGCAGTACCATCCGCGCGAACAAGTACGAGTGCACCTGGGTTAATTAATTTCCCGGACAGTGTGGCGACCAATCGTAGACGGGACTTTCTGGAGTGATGGAAACTGAGGCTCCTCGACGCAAGCCATGTGACGACGAGGCCCGTGCCGTGCCTTTATCAACCAATGGGACATGGGACACCAATGCGGCGATGATCAACAAATTTGCTCGTGCCACCGATACATTGTATCTCTCCGGTTGTCAAACACAGCACCCGAAAACGTCAGTTCTTAATCGCTCATTCTTGTAGCCTGATCAGGCATCAGATTTTAAAGCGTCCAA

Full Affymetrix probeset data:

Annotations for 1638107_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720