FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638108_at:

>probe:Drosophila_2:1638108_at:266:317; Interrogation_Position=112; Antisense; GCCTCGGGCTGCAAGGATTGTTCAT
>probe:Drosophila_2:1638108_at:451:713; Interrogation_Position=132; Antisense; TTCATGCGTGATTTGTGGACCTGGT
>probe:Drosophila_2:1638108_at:197:267; Interrogation_Position=159; Antisense; CGAGCCGTGTCCTGGGTGTTCCGCA
>probe:Drosophila_2:1638108_at:44:471; Interrogation_Position=187; Antisense; GTTCCCGTCTGCAAAGATCTGATCA
>probe:Drosophila_2:1638108_at:395:151; Interrogation_Position=212; Antisense; ACATTATGGAGGGTCTTGAGCGGCA
>probe:Drosophila_2:1638108_at:409:333; Interrogation_Position=270; Antisense; GCTGTTCTAGAGATGTGCCCTCAAC
>probe:Drosophila_2:1638108_at:601:677; Interrogation_Position=277; Antisense; TAGAGATGTGCCCTCAACCTAATCG
>probe:Drosophila_2:1638108_at:137:157; Interrogation_Position=292; Antisense; AACCTAATCGGCACTGACCTTTTAT
>probe:Drosophila_2:1638108_at:411:283; Interrogation_Position=305; Antisense; CTGACCTTTTATCTGCTGGCATTTA
>probe:Drosophila_2:1638108_at:25:287; Interrogation_Position=320; Antisense; CTGGCATTTAAAACTGCTGTCTAAT
>probe:Drosophila_2:1638108_at:147:179; Interrogation_Position=346; Antisense; AAACTATTATCATTCCTGCACGACC
>probe:Drosophila_2:1638108_at:479:203; Interrogation_Position=48; Antisense; AACCATGAAGCTGCTCGTTGTCGCC
>probe:Drosophila_2:1638108_at:459:467; Interrogation_Position=64; Antisense; GTTGTCGCCGTCATTGCGTGCATCA
>probe:Drosophila_2:1638108_at:655:327; Interrogation_Position=79; Antisense; GCGTGCATCATGCTCATCGGATTCG

Paste this into a BLAST search page for me
GCCTCGGGCTGCAAGGATTGTTCATTTCATGCGTGATTTGTGGACCTGGTCGAGCCGTGTCCTGGGTGTTCCGCAGTTCCCGTCTGCAAAGATCTGATCAACATTATGGAGGGTCTTGAGCGGCAGCTGTTCTAGAGATGTGCCCTCAACTAGAGATGTGCCCTCAACCTAATCGAACCTAATCGGCACTGACCTTTTATCTGACCTTTTATCTGCTGGCATTTACTGGCATTTAAAACTGCTGTCTAATAAACTATTATCATTCCTGCACGACCAACCATGAAGCTGCTCGTTGTCGCCGTTGTCGCCGTCATTGCGTGCATCAGCGTGCATCATGCTCATCGGATTCG

Full Affymetrix probeset data:

Annotations for 1638108_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720