Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638109_s_at:

>probe:Drosophila_2:1638109_s_at:94:699; Interrogation_Position=138; Antisense; TTCTACGGCAAAGCCGATGTGCCCT
>probe:Drosophila_2:1638109_s_at:135:293; Interrogation_Position=152; Antisense; CGATGTGCCCTTCGGCCAGGTCAAG
>probe:Drosophila_2:1638109_s_at:229:569; Interrogation_Position=262; Antisense; GGCAGCACAAGTACGTGTTCCCAAA
>probe:Drosophila_2:1638109_s_at:683:633; Interrogation_Position=322; Antisense; TCGCCAGCATGACGTTCTTCTATCT
>probe:Drosophila_2:1638109_s_at:191:665; Interrogation_Position=354; Antisense; TACACCAAGTTGAAGCACCACAGGA
>probe:Drosophila_2:1638109_s_at:640:665; Interrogation_Position=381; Antisense; TACAAGTACCACTAAGCGGCGCTGC
>probe:Drosophila_2:1638109_s_at:435:359; Interrogation_Position=423; Antisense; GCAACAGATTCTACACTTTCCACAA
>probe:Drosophila_2:1638109_s_at:577:665; Interrogation_Position=434; Antisense; TACACTTTCCACAAGGCGTGCGAGA
>probe:Drosophila_2:1638109_s_at:44:331; Interrogation_Position=460; Antisense; GCGGGCAATCACCACTAAACTATAT
>probe:Drosophila_2:1638109_s_at:697:37; Interrogation_Position=483; Antisense; ATCTATTTGGCTTTTGTGTTTTGAA
>probe:Drosophila_2:1638109_s_at:6:179; Interrogation_Position=525; Antisense; AAACGGCTGCGAATATCCATGCTGC
>probe:Drosophila_2:1638109_s_at:164:49; Interrogation_Position=539; Antisense; ATCCATGCTGCCATAGACTCAGACT
>probe:Drosophila_2:1638109_s_at:476:439; Interrogation_Position=71; Antisense; GATGGCATTCGGTGACTATCCAGCT
>probe:Drosophila_2:1638109_s_at:317:683; Interrogation_Position=87; Antisense; TATCCAGCTGAGTACAACCCCAAGG

Paste this into a BLAST search page for me
TTCTACGGCAAAGCCGATGTGCCCTCGATGTGCCCTTCGGCCAGGTCAAGGGCAGCACAAGTACGTGTTCCCAAATCGCCAGCATGACGTTCTTCTATCTTACACCAAGTTGAAGCACCACAGGATACAAGTACCACTAAGCGGCGCTGCGCAACAGATTCTACACTTTCCACAATACACTTTCCACAAGGCGTGCGAGAGCGGGCAATCACCACTAAACTATATATCTATTTGGCTTTTGTGTTTTGAAAAACGGCTGCGAATATCCATGCTGCATCCATGCTGCCATAGACTCAGACTGATGGCATTCGGTGACTATCCAGCTTATCCAGCTGAGTACAACCCCAAGG

Full Affymetrix probeset data:

Annotations for 1638109_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime