FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638112_at:

>probe:Drosophila_2:1638112_at:120:75; Interrogation_Position=1713; Antisense; AGGAGAAGTCCGAATTCCTGCTCTC
>probe:Drosophila_2:1638112_at:162:617; Interrogation_Position=1731; Antisense; TGCTCTCGCCGACGGAAAAACGTTT
>probe:Drosophila_2:1638112_at:36:181; Interrogation_Position=1747; Antisense; AAAACGTTTGCAGGCCAACTCGAAG
>probe:Drosophila_2:1638112_at:227:491; Interrogation_Position=1777; Antisense; GTACACACGCAAGAGCAAGTCGCCG
>probe:Drosophila_2:1638112_at:50:499; Interrogation_Position=1858; Antisense; GTCTTCATCAGCCTGTCAGCATAAA
>probe:Drosophila_2:1638112_at:320:31; Interrogation_Position=1878; Antisense; ATAAAGACGGCGGTGCCTCCAAGTG
>probe:Drosophila_2:1638112_at:456:233; Interrogation_Position=1908; Antisense; AATGCCGCGAGTGCCGTGAATGCAA
>probe:Drosophila_2:1638112_at:596:201; Interrogation_Position=1945; Antisense; AACCGAAGCGATGTACTGCCACTTG
>probe:Drosophila_2:1638112_at:620:311; Interrogation_Position=1962; Antisense; GCCACTTGTGCAGCGGATTATACCA
>probe:Drosophila_2:1638112_at:461:557; Interrogation_Position=1990; Antisense; GGACTGCCACGAGTTCACCAAAAAT
>probe:Drosophila_2:1638112_at:220:607; Interrogation_Position=2022; Antisense; TGATGCAGCTGCAGAACTCTCGCTG
>probe:Drosophila_2:1638112_at:602:485; Interrogation_Position=2083; Antisense; GTAGTGCGTTGCCAAGTGAGCCATT
>probe:Drosophila_2:1638112_at:444:231; Interrogation_Position=2115; Antisense; AATGTTTCTCATTCTTGCATAAAGG
>probe:Drosophila_2:1638112_at:88:133; Interrogation_Position=2159; Antisense; ACCCTAGTTGGTATGCTGAGTTCGT

Paste this into a BLAST search page for me
AGGAGAAGTCCGAATTCCTGCTCTCTGCTCTCGCCGACGGAAAAACGTTTAAAACGTTTGCAGGCCAACTCGAAGGTACACACGCAAGAGCAAGTCGCCGGTCTTCATCAGCCTGTCAGCATAAAATAAAGACGGCGGTGCCTCCAAGTGAATGCCGCGAGTGCCGTGAATGCAAAACCGAAGCGATGTACTGCCACTTGGCCACTTGTGCAGCGGATTATACCAGGACTGCCACGAGTTCACCAAAAATTGATGCAGCTGCAGAACTCTCGCTGGTAGTGCGTTGCCAAGTGAGCCATTAATGTTTCTCATTCTTGCATAAAGGACCCTAGTTGGTATGCTGAGTTCGT

Full Affymetrix probeset data:

Annotations for 1638112_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720