Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638113_at:

>probe:Drosophila_2:1638113_at:70:193; Interrogation_Position=1305; Antisense; AACTTTCACTTGGTACTTAGCAGAG
>probe:Drosophila_2:1638113_at:582:351; Interrogation_Position=1324; Antisense; GCAGAGCTAAAGAACTCCGAGCGCA
>probe:Drosophila_2:1638113_at:198:633; Interrogation_Position=1339; Antisense; TCCGAGCGCAAAAGTTAGCCTGCAT
>probe:Drosophila_2:1638113_at:506:399; Interrogation_Position=1368; Antisense; GACAGCGTTACAATACGTGACCTTT
>probe:Drosophila_2:1638113_at:574:511; Interrogation_Position=1384; Antisense; GTGACCTTTCCAACTCTCAAATATG
>probe:Drosophila_2:1638113_at:723:71; Interrogation_Position=1420; Antisense; AGGACAACATTACTTTCACAAACGG
>probe:Drosophila_2:1638113_at:302:255; Interrogation_Position=1436; Antisense; CACAAACGGTAGTCTCTTTTAATAG
>probe:Drosophila_2:1638113_at:541:269; Interrogation_Position=1471; Antisense; CATGGCGGCATGGTTAGAATATTAG
>probe:Drosophila_2:1638113_at:439:485; Interrogation_Position=1548; Antisense; GTAGTATACTTTTAATCCATCATTT
>probe:Drosophila_2:1638113_at:621:675; Interrogation_Position=1572; Antisense; TAGCTTCAATTCGTAATCCAAGAAC
>probe:Drosophila_2:1638113_at:525:657; Interrogation_Position=1602; Antisense; TAAGAACTCGTCTCTGTAGCAATAA
>probe:Drosophila_2:1638113_at:426:581; Interrogation_Position=1616; Antisense; TGTAGCAATAATCCTCCCGTTTCAC
>probe:Drosophila_2:1638113_at:257:301; Interrogation_Position=1631; Antisense; CCCGTTTCACTACTCAAAGTGCTCA
>probe:Drosophila_2:1638113_at:256:393; Interrogation_Position=1761; Antisense; GAAAGCTACACCTATTCCTACAAGG

Paste this into a BLAST search page for me
AACTTTCACTTGGTACTTAGCAGAGGCAGAGCTAAAGAACTCCGAGCGCATCCGAGCGCAAAAGTTAGCCTGCATGACAGCGTTACAATACGTGACCTTTGTGACCTTTCCAACTCTCAAATATGAGGACAACATTACTTTCACAAACGGCACAAACGGTAGTCTCTTTTAATAGCATGGCGGCATGGTTAGAATATTAGGTAGTATACTTTTAATCCATCATTTTAGCTTCAATTCGTAATCCAAGAACTAAGAACTCGTCTCTGTAGCAATAATGTAGCAATAATCCTCCCGTTTCACCCCGTTTCACTACTCAAAGTGCTCAGAAAGCTACACCTATTCCTACAAGG

Full Affymetrix probeset data:

Annotations for 1638113_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime