FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638114_at:

>probe:Drosophila_2:1638114_at:661:591; Interrogation_Position=114; Antisense; TGGTCCGCTGAACTTTGTGCATCAA
>probe:Drosophila_2:1638114_at:182:149; Interrogation_Position=125; Antisense; ACTTTGTGCATCAATCTCTGAGGAC
>probe:Drosophila_2:1638114_at:413:115; Interrogation_Position=198; Antisense; AGCAGTGGCAACATCTTCGCTGAGT
>probe:Drosophila_2:1638114_at:390:605; Interrogation_Position=218; Antisense; TGAGTGCGGGCTACCAATTAGCATC
>probe:Drosophila_2:1638114_at:142:15; Interrogation_Position=234; Antisense; ATTAGCATCGACCAACCACCTGAAG
>probe:Drosophila_2:1638114_at:729:689; Interrogation_Position=280; Antisense; TTTGATTTCAGCACCGACCAGATGT
>probe:Drosophila_2:1638114_at:438:455; Interrogation_Position=32; Antisense; GATACTCCTACAACACGGATGGCGA
>probe:Drosophila_2:1638114_at:595:687; Interrogation_Position=339; Antisense; TTTGGGCAAGTACTCCTACTACGAT
>probe:Drosophila_2:1638114_at:78:279; Interrogation_Position=354; Antisense; CTACTACGATGAGGCTGGCTACCAT
>probe:Drosophila_2:1638114_at:330:333; Interrogation_Position=367; Antisense; GCTGGCTACCATGAGCTGAGCTACA
>probe:Drosophila_2:1638114_at:341:167; Interrogation_Position=498; Antisense; AAATGCCTTGACTAGCCTGCAAGAG
>probe:Drosophila_2:1638114_at:527:469; Interrogation_Position=522; Antisense; GTTGCATAAATATCGTGGCTACACG
>probe:Drosophila_2:1638114_at:715:549; Interrogation_Position=68; Antisense; GGAGTGTCGTTAAGCCTAGTTTTGG
>probe:Drosophila_2:1638114_at:194:525; Interrogation_Position=92; Antisense; GGGCATCTTCTCTGGATTCCTTTGG

Paste this into a BLAST search page for me
TGGTCCGCTGAACTTTGTGCATCAAACTTTGTGCATCAATCTCTGAGGACAGCAGTGGCAACATCTTCGCTGAGTTGAGTGCGGGCTACCAATTAGCATCATTAGCATCGACCAACCACCTGAAGTTTGATTTCAGCACCGACCAGATGTGATACTCCTACAACACGGATGGCGATTTGGGCAAGTACTCCTACTACGATCTACTACGATGAGGCTGGCTACCATGCTGGCTACCATGAGCTGAGCTACAAAATGCCTTGACTAGCCTGCAAGAGGTTGCATAAATATCGTGGCTACACGGGAGTGTCGTTAAGCCTAGTTTTGGGGGCATCTTCTCTGGATTCCTTTGG

Full Affymetrix probeset data:

Annotations for 1638114_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720