Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1638118_at:

>probe:Drosophila_2:1638118_at:232:117; Interrogation_Position=316; Antisense; AGCTTGTTCTCCTCGAGCTATGTAA
>probe:Drosophila_2:1638118_at:711:83; Interrogation_Position=353; Antisense; AGTGGATGAATCTGCCATTGGCCTA
>probe:Drosophila_2:1638118_at:446:683; Interrogation_Position=376; Antisense; TATGCTCCGTGTTTCGATGGTCGCG
>probe:Drosophila_2:1638118_at:728:327; Interrogation_Position=398; Antisense; GCGTTGTTCTGTATCCTTCGGAGCA
>probe:Drosophila_2:1638118_at:5:171; Interrogation_Position=429; Antisense; AAAGGACTATCTCAGCTGGCGACAG
>probe:Drosophila_2:1638118_at:354:401; Interrogation_Position=449; Antisense; GACAGGCCGATGTGCATGTGAACAA
>probe:Drosophila_2:1638118_at:478:511; Interrogation_Position=466; Antisense; GTGAACAACCTGTACAATACCGCCT
>probe:Drosophila_2:1638118_at:6:661; Interrogation_Position=478; Antisense; TACAATACCGCCTTTTGGAAACTCG
>probe:Drosophila_2:1638118_at:310:611; Interrogation_Position=518; Antisense; TGACGAACCAGCAAGCCGAGGCGAA
>probe:Drosophila_2:1638118_at:535:417; Interrogation_Position=574; Antisense; GAGCTGCTCTTCCAGGAATTCGGGA
>probe:Drosophila_2:1638118_at:490:161; Interrogation_Position=600; Antisense; AAATTACAACAATCTGCCGGCAATG
>probe:Drosophila_2:1638118_at:398:507; Interrogation_Position=691; Antisense; GTGCCGCTGCACGAGGATCTGATAT
>probe:Drosophila_2:1638118_at:510:451; Interrogation_Position=706; Antisense; GATCTGATATCTTCGCAGTTCTGGA
>probe:Drosophila_2:1638118_at:53:29; Interrogation_Position=786; Antisense; AACTTTTCCCCGATTGGTGGAGATG

Paste this into a BLAST search page for me
AGCTTGTTCTCCTCGAGCTATGTAAAGTGGATGAATCTGCCATTGGCCTATATGCTCCGTGTTTCGATGGTCGCGGCGTTGTTCTGTATCCTTCGGAGCAAAAGGACTATCTCAGCTGGCGACAGGACAGGCCGATGTGCATGTGAACAAGTGAACAACCTGTACAATACCGCCTTACAATACCGCCTTTTGGAAACTCGTGACGAACCAGCAAGCCGAGGCGAAGAGCTGCTCTTCCAGGAATTCGGGAAAATTACAACAATCTGCCGGCAATGGTGCCGCTGCACGAGGATCTGATATGATCTGATATCTTCGCAGTTCTGGAAACTTTTCCCCGATTGGTGGAGATG

Full Affymetrix probeset data:

Annotations for 1638118_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime